Skip to main content

Full text of "USPTO Patents Application 09864621"

See other formats


This Page Is Inserted by IFW Operations 
and is not a part of the Official Record 



BEST AVAILABLE IMAGES 



Defective images within this document are accurate representations of 
the original documents submitted by the apphcant. 

Defects in the images may include (but are not limited to): 



BLACK BORDERS 

TEXT CUT OFF AT TOP, BOTTOM OR SIDES 
FADED TEXT 
ILLEGIBLE TEXT 
SKEWED/SLANTED IMAGES 
COLORED PHOTOS 

BLACK OR VERY BLACK AND WHITE DARK PHOTOS 
GRAY SCALE DOCUMENTS 



IMAGES ARE BEST AVAILABLE COPY. 



As rescanning documents will not correct images, 
please do not report the images to the 
Image Problem Mailbox. 



THIS PAGE BLANK (uspto) 



C12Q 1/68, C12N 15/12 



Al 



(43) International Publication Date: 4 March 1999 (04.03^9) 



(il) International Application Number: PGT/US98/ 17283 

(22) anternation;il Filing Date: 21 August 1998 (2 L08.98) 



(30) Priority Data: 
60/G56.K61 



22 August 1997 (22.08.97) 



US 



(71) Applicanr C/'W' t''/ designated States except US): YALE UNI- 
VERSm' (i:S'USI: 451 College Street, New Haven, CT 
06520 (US). 



(81) Designated States: AU. CA, XL, JP, US. European patent (AT. 
BE. CH. fey. DE, DK, ES. FI. FR, GB. GR. IE. IT. LU. 
MC. NL. Pt. SE). 



Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



(72) Inventors; and 

(75) Inventors/Applicants (for US only)'. LIU. Meng [CN/US]; 
Apartmcni 7C. 564 Prospect Street. New Haven. CT 06511 
(US). BASK ARAN. Namadev [INAJS]; 750 Whitney Av- 
enue. New Haven. CT 0651 1 (US), WEISSMAN. Sherman, 
M. [US/USJ; 459 Saint Ronan Street, New Haven, CT06511 
(US). 

(74) Agent: ADLER. Rcid. G.; Morgan, Lewis & Bockius LLP, 
1800 M Street, N.W., Washington, DC 20036 (US). 



(54) Tide: A PROCESS TO STUDY CHANGES IN GENE EXPRESSION IN STEM CELLS 
(57) Abstract 

The present invention includes a method to identify stem cell genes that are differentially expressed in stem cells at various stages of 
differentiation when compared to undifferenUated stem ceUs by preparing a gene expression profile of a stem cell populaUon and companng 
die profile to a profile prepared from stem cells at different stages of differentiation, thereby identifying cDNA species, and therefore genes, 
which are expressed. The present invention also includes methods to identify a therapeutic agent that modulates the expression of at least 
one stem eel! gene associated with the differentiation, proliferation and/or survival of stem cells. 



FOR THE PURPOSES OF INFORMATION ONLY 
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCT. 



AL 


Albania 


£S 


Spain 


LS 


Lesotho 


SI 


Slovenia^ 


AM 


Annenia 


FX 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senegal 


AU 


Australia 


GA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


G£ 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan . 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin 


IE 


Ereland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


UZ 


Uzbekistan 


CF 


Central Airican Republic 


JP 


Japan 


NE 


Niger 


VN 


Vict Nam 


CG 


Congo 


K£ 


FCenya 


NL 


Netherlands 


vu 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzstan 


NO 


Norway 


zw 


Zimbabwe 


CI 


Cdte d'lvoire 


KP 


Democratic People's 


N2 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






CU 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






CZ 


Czech Republic 


LC 


Saint Luda 


RU 


Russian Federation 






DE 


Germany 


U 


Liechtenstein 


SD 


Sudan 






DK 


^ Denmarlc 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 








wo 99/10535 PCT/US98/17283 



-1- 

A PROCESS TO STUDY CHANGES 
IN GENE EXPRESSION IN STEM CELLS 



TftKhnical Field 

This invention relates to compositions and methods useful to identify agents that 
modulate the expression of at least one gene associated with the differentiation, 
proliferation, dedication and'or survival of stem cells. 

5 background of the Invention 

The identification of genes associated with development and differentiation of 
cells is an important step for advancing our understanding of hematopoiesis, the 
differentiation of hematopoietic stem cells into erytiirocytes, monocytes, platelets and 
polymorphonuclear white hlood cells or granulocytes. The identification of genes 

10 associated with hematopoiesis is also an important step for advancing the development of 
therapeutic agents which modulate, promote or interfere with the differentiation of stem 
cells. 

Hematopoietic stem cells derive from bone marrow stem cells. The bone marrow 
stem cells ultimately differentiate into the hematopoietic stem cells, which are 

1 5 responsible for the lymphoid, myeloid and erythroid lineages, and sti-omal stem cells, 
which differentiate into fibroblasts, osteoblasts, smooth muscle cells, stromal cells and 
adipocytes (Stewart Sell, Immunology, Immunopathology & Immunity, 5th ed. 39- 
42 Stamford, CT, 1996). The lymphoid lineage, comprising B-cells and T-cells, provides 
for the production of antibodies, regulation of tiie cellular immune system, detection of 

20 foreign agents in the blood, detection of cells foreign to the host, and the like. The 
myeloid lineage, which includes monocytes, granulocytes, megakaryocytes as well as 
others cells, monitors for the presence of foreign bodies in tiie blood sti-eam, provides 
protection against neoplastic cells, scavenges foreign materials in the blood stream. 



wo 99/10535 



PCT/US98/17283 



-2- 

produces platelets and the like. The erythroid lineage provides the red blood cells which 
act as oxygen carriers. 

Hematopoietic stem cells differentiate as a result from their interaction with 
growth factors such as interleukins (ILs), lymphokines, colony-stimulating factors 
5 (CSFs), erythropoietin (epo), and stem cell factor (SCF). Each of these growth factors 
have multiple actions that are not necessarily limited to the hematopoietic system 
(Robert A. Meyers, ed.. Molecular Biology and Biotechnology: A 
Comprehensive Desk Reference, 392-6, New York, 1995). Proliferation, 
differentiation and survival of immature hematopoietic progenitor cells are sustained by 

10 hematopoietic growth factors (hemopoietins). These growth factors also influence the 
survival and function of mature blood cells. The kinetics of hematopoiesis vary 
depending on cell type, and their life span may be as little as 6-12 hours to as much as 
months or years. As a result, the daily renewal of certain lymphocyte progenitors may be 
substantially lower than that of leukocytic progenitors. The most primitive cells, 

1 5 pluripotent stem cells (PSCs), have high self-renewal capacity (Nathan, 8 1 8-821 ; Saito, 
Recent trends in research on differentiation of hematopoietic cells and lymphokines ^ 
Hum. Cell. 5fn: 54(1992)), 

Growth factors are responsible for differentiating the hematopoietic stem cell into 
either the hemocytoblast, which is the progenitor cell of erythrocytes, neutrophils, 
. 20 eosinophils, basophils, monocytes and platelets, and lymphoid stem cells, which are 

progenitors to T cells and B cells. SELL, 41 . These circulating blood cells are products 
of terminal differentiation of recognizable precursors (e.g.y erythroblasts, mono- 
myeloblasts and megakaryoblasts, to name but a few). The terminal differentiation of 
these recognizable precursors may occur exclusively in the marrow cavities of the axial 

25 skeleton, with some extension into the proximal femora and humeri (David G. Nathan, 
Hematologic Diseases, IN CECIL TEXTBOOK OF MEDICINE 20th ed., 817, Philadelphia, 
1996). White blood cell (WBC) nomenclature may be divided into two major 
populations on the basis of the form of their nuclei: single nuclei (mononuclear oV "round 
cells") or segmented nuclei (polymorphonuclear). 



wo 99/10535 



PCTAJS98/17283 



-3- 

In human medicine, the ability to initiate and regulate hematopoiesis is of great 
importance (McCune et al.,The SCID-hu mouse: murine model for the analysis of human 
hematolymphoid differentiation and function. Science 241 : 1 632(1988)). A variety of 
diseases and immune disorders, including malignancies, appear to be related to 
5 disruptions within the lympho-hematopoietic system. Many of these disorders could be 
alleviated and/or cured by repopulating the hematopoietic system with progenitor cells, 
which when triggered to differentiate would overcome the patient's deficiency. In 
humans, a current replacement therapy is bone marrow transplantation. This type of 
therapy, however, is both painful (for donor and recipient) because of involvement of 
1 0 invasive procedures and can offer severe complications to the recipient, particularly when 
the graft is allogeneic and Grafl Versus Host Disease (GVHD) results. Therefore, the 
risk of GVHD restricts the use of bone marrow transplantation to patients with otherwise 
fatal diseases. A potentially more exciting alternative therapy for hematopoietic 
disorders is the treatment of patients with reagents that regulate the proliferation and 
15 differentiation of stem cells (Lawman et al, U.S. Patent No. 5,650,299 (1997)). 

There is also a strong interest in the development of procedures to produce large 
numbers of the human hematopoietic stem cell. This will allow for identification of 
growth factors associated with its self rejgeneration. Additionally, there may be as yet 
undiscovered growth factors associated (1) with the early steps of dedication Of the stem 
20 cell to a particular lineage; (2) the prevention of such dedication; and (3) the negative 
control of stem cell proliferation. Availability of large numbers of stem cells would be 
extremely useful in bone marrow transplantation, as well as transplantation of other 
organs in association with the transplantation of bone marrow. 

An in vitro system that permits determination of what agents induce 
25 differentiation or proliferation of progenitor cells within a hematopoietic cell population 
would have many applications. For example, controlled production of red blood cells 
would pemiit the in vitro production of red blood cell units for cUnical replacement, 
(transfusion) therapy. As is well known, transfused red cells are used in the treatment of 
anemia following elective surgery, in cases of traumatic blood loss, and in the supportive 
30 care of, e.g. , cancer patients. Similarly, controlled production of platelets would permit 



wo 99/10535 



PCT/US98/I7283 



-4- 

- the in vitro production of platelets for platelet transfusion therapy, which may be used in 
cancer patients with thrombocytopenia caused by chemotherapy. For both red cells and 
platelets, current volunteer donor pools are accompanied by the risk of infectious 
contamination, and availability of an adequate supply can be limited. Determination of 
5 such compounds would lend itself to developing methods of controlled in vitro 
production of specified lineage of mature blood cells to circumvent these problems 
(Palsson et al, U.S. Patent No. 5,635,386 (1997)). 

Alternatively, agents could be isolated that selectively deplete a particular lineage 
of cells from within a hematopoietic cell population and can similarly confer important 

10 advantages. For example, production of stem cells and myeloid cells while selectively 
depleting T-cells from a bone marrow cell population could be very important for the 
management of patients with human inraumodeficiency virus (HIV) infection. Since the 
major reservoir of HIV is the pool of mature T-cells, selective eradication of the mature 
T-cells from a hematopoietic cell mass collected from a patient has considerable potential 

15 therapeutic benefit. If one could selectively remove all the mature T-cells from within an 
HIV infected bone marrow cell population while maintaining viable stem cells, the T-cell 
depleted bone marrow sample could then be used to "rescue" the patient following 
hematolymphoid ablation and autologous bone marrow transplantation. Although there 
are reports of the isolation of progenitor cells (see, e.g., Tsukamoto et aiy (1991) as 

20 representative) such techniques are distinct from the selective removal of T-cells from a 
hematopoietic tissue culture (Palsson et ai, U.S. Patent No. 5,635,386 (1997)). 

Summarv of the Invention 

While the differentiation of stem cells has been the subject of intense study, little 
is known about the global transcriptional response of stem cells during cell - 
25 hematopoiesis. The present inventors have devised an approach to systematically assess 
the transcriptional regulation of stem cells during hematopoiesis as well as methods for 
the identification of agents that modulate the expression of at least one gene associated 
with hematopoiesis. 



wo 99/10535 



PCTAJS98/17283 



-5- 

The present invention includes a method to identify stem cell genes that are 
differentially expressed in stem cells at various stages of differentiation when compared 
to undifferentiated stem cells by preparing a gene expression profile of a stem cell 
population and comparing the profile to a profile prepared from stem cells at different 
5 stages of differentiation, thereby identifying cDNA species, and therefore genes, which 
are expressed. 

The present invention further includes a method to identify an agent that 
modulates the expression of at least one steni cell gene associated with the differentiation 
process of a stem cell population, comprising the steps of preparing a first gene 

10 expression profile of an undifferentiated stem cell population, preparing a second gene 
expression profile of a stem cell population at a defined stage of differentiation, treatmg 
said undifferentiated stem cell population with the agent, preparing a third gene 
expression profile of the treated stem cell population, and comparing the first, second and 
third gene expression profiles. Comparison of the three gene expression profiles for 

1 5 RNA species as represented by cDNA Augments that are differentially expressed upon 
addition of the agent to the undifferentiated stem cell population identifies agents that 
modulate the expression of at least one gene in imdifferentiated stem cells that is 
associated with stem cell differentiation. 

Another aspect of the invention is a composition comprising a grouping of nucleic 

20 acids or nucleic acid fi-agments affixed to a solid support. The nucleic acids affixed to 
the solid support correspond to one or more genes whose expression levels are modulated 
during stem cell differentiation. 

Brief Description of the Drawings 

Fig. 1 Figure 1 is an autoradiogram of the gene expression profiles generated 
25 fi-om cDNAs made with RNA isolated fi-om Lin^, LRH, LRH48 and LRBRH cells. All 
possible 12 anchoring oligo d(T)nl, n2 were used to generate a complete expression 
profile for the enzyme Clal. 



wo 99/10535 



PCTAJS98/17283 



-6- 

Modes of Carrying Out the Invention 
General Description 

The differentiation of stem cells during the process of hematopoiesis is a subject 
of primary importance in view of the need to find ways to modulate the stem cell 
5 differentiation process. One means of characterizing the process of hematopoiesis is to 
measure the ability of stem cells to synthesize specific RNA during stem cell 
differentiation. 

The following discussion presents a general description of the invention as well 
definitions for certain terms used herein. 

10 Definitions 

The term "stem cells" as used herein, refers to both hematopoietic stem cells and 
bone marrow stem cells, and includes totipotent cells which serve as progenitors of 
neoplastic transformation. The term "hematopoietic stem cells" refers to stem cells 
which differentiate into erythrocytes, monocytes, granulocytes, and platelets. The 
15 putative human hematopoietic stem cell may express the cell surface antigen CD34. 

The term "hematopoiesis " as used herein, refers to the process by which stem cells 
differentiate into blood cells, including erythrocytes, monocytes, granulocytes, and 
platelets. 

The term "blood cell", as used herein, refers to all blood cell types derived from the 
20 process of hematopoiesis (see Stewart Sell, Immunology, Immunopa thology & 
Immunity, 5th ed. 39-42, Stamford, CT, 1996) 

The term "solid support", as used herein, refers to any support to which nucleic acids 
can be bound or immobilized, incliiding nitrocellulose, nylon, glass, other solid supports 
which are positively charged and nanochannel glass arrays disclosed by Beattie (WO 
25 95/1175). 

The term "gene expression profile", also referred to as a "differential expression 
profile" or "expression profile" refers to any representation of the expression level of at 



wo 99/10535 



PCX AJS98/1 7283 



-7- 

- least one mRNA species in a cell sample or population. For instance, a gene expression 
profile can refer to an autoradiograph of labeled cDNA fragments produced from total 
cellular mRNA separated on the basis of size by known procedures. Such procedures 
include slab gel electrophoresis, capillary gene electrophoresis, high performance liquid 
5 chromatography, and the like. Digitized representations of scanned electrophoresis gels 
are also included as are two and three dimensional representations of the digitized data. 

While a gene expression profile encompasses a representation of the expression level 
of at least one mRNA species, in practice, the typical gene expression profile represents 
the expression level of multiple mRNA species. For instance, a gene expression profile 
10 useful in the methods and compositions disclosed herein represents the expression levels 
of at least about 5, 10, 20, 50, 100 , 150, 200, 300, 500, 1000 or more preferably, 
substantially all of the detectable mRNA species in a cell sample or population. 
Particularly preferred are gene expression profiles or arrays affixed to a solid support that 
contain a sufficient representative number of mRNA species whose expression levels are 
1 5 modulated under the relevant infection, disease, screening, treatment or other 

experimental conditions. In some instances a sufficient representative number of such 
mRNA species will be about 1, 2, 5, 10, 15, 20, 25, 30, 40, 50, 50-75 or 100. 

Gene expression profiles can be produced by any means known in the art, including, 
but not limited to the methods disclosed by: Prashar et al. (1996) Proc, NatL Acad. ScL 
20 USA 93:659-663; Liang et al. (1992) Science 257:967-971; Ivanova et al. (1995) Nucleic 
Acids Res. 23:2954-2958; Guilfoyl et al. {1997) Nucleic Acids Res, 25(9):1854-1858; 
Chee et al. (1996) Science 274:610-6)4; Velculescu et al. (1995) Science 270:484-487; 
Fischer et al. (1995) Proc. NatL Acad. Sci. USA 92(12):5331-5335; and Kato (1995) 
Nucleic Acids Res. 23(1 8):3685-3690. 
25 As an example, gene expression profiles are made to identify one or more genes 
whose expression levels are modulated during the process of stem cell differentiation. 
The assaying of the modulation of gene expression via the production of a gene 
expression profile generally involves the production of cDNA from poly A* RNA 
(mRNA) isolated from stem cells as described below. 



wo 99/10535 



PCT/US98/17283 



-8- 

Stem cells are harvested or isolated by any technique known in the art. One of the 
most versatile ways to separate hematopoietic cells is by use of flow cytometry, where 
the particles, /.e,. cells, can be detected by fluorescence or light scattering. The source of 
the cells may be any source which is convenient. Thus, various tissues, organs, fluids, or 
5 the like may be the source of the cellular mixtures. Of particular interest are bone 

marrow and peripheral blood, although other lymphoid tissues are also of interest, such as 
spleen, thymus, and lymph node (see Sasaki et ai, U.S. Patent No. SA^^jSll and Fei et 
aL, U.S. Patent No. 5,635,387). 

Cells of interest will usually be detected and separated by virtue of surface membrane 

10 proteins which are characteristic of the cells. For example, CD34 is a marker for 

immature hematopoietic cells. Markers for dedicated cells may include CD 10, CD 19, 
CD20, and sig for B cells, CD 15 for granulocytes, CD 16 and CD33 for myeloid cells, 
CD 14 for monocytes, CD41 for megakaryocytes, CD38 for lineage dedicated cells, CD3, 
CD4, CD7, CDS and T cell receptor (TCR) for T cells, Thy-1 for progenitor cells, 

15 glycophorin for erythroid progenitors and CD71 for activated T cells. In isolating early 
progenitors, one may divide a CD34 positive enriched fraction into lineage (Lin) 
negative, e.g. CD2 - , CD 14 - , CD15 - , CD16 - , CDIO - , CD19 • , CD33 - and 
glycophorin A - , fractions by negatively selecting for markers expressed on lineage 
committed cells^ Thy-1 positive fractions, or into CD38 negative fractions to provide a 

20 composition substantially enriched for early progenitor cells. Other markers of interest 
include V alpha and V beta chains of the T-cell receptor (Sasaki et al, U. S. Patent No. 
5,466,572(1995)). 

After isolation of the appropriate stem cells, total cellular mRNA is isolated from the 
cell sample. mRNAs are isolated from cells by any one of a variety of techniques. 

25 Numerous techniques are well known {see e.., Sambrook et al.. Molecular Cloning: A 
Laboratory Approach, Cold Spring harbor Press, NY, 1987; Ausbel et.. Current 
Protocols in Molecular Biology, Greene Publishing Co. NY, 1995). In general, these 
techniques first lyse the cells and then enrich for or purify RNA. In one such protocol, 
cells are lysed in a Tris-buffered solution containing SDS. The lysate is extracted with 

30 phenol/chloroform, and nucleic acids precipitated. The mRNAs may be purified from 



wo 99/10535 



PCTAJS98/17283 



-9- 

cmde preparations of nucleic acids or from total RNA by chromatography, such as 
binding and elution from oligo(dT)-cellulose or poly(U)-Sepharose®. However, 
purification of poly(A)-containing RNA is not a requirement. As stated above, other 
protocols and methods for isolation of RNAs may be substituted. 

5 The mRNAs are reverse transcribed using an RNA-directed DNA polymerase, such as 
reverse transcriptase isolated from AMV, MoMuLV or recombinantly produced. Many 
commercial sources of enzyme are available (e.g. Pharmacia, New England Biolabs, 
Stratagene Cloning Systems). Suitable buffers., cofactors, and conditions are well known 
and supplied by manufacturers (see also, Sambrook et al. (1989) Molecular Cloning: a 

1 0 laboratory manual, 2nd Ed., Cold Spring Harbor Laboratory; and Ausbel et al. (\ 987) 
Current Protocols in Molecular Biology, Greene Publishing and Wiley-Interscience, 
N.Y.). 

Various oligonucleotides are used in the production of cDNA. In particular, the 
methods utilize oligonucleotide primers for cDN A synthesis, adapters, and primers for 

15 amplification. Oligonucleotides are generally synthesized so single strands by standard 
chemistry techniques, including automated synthesis. Oligonucleotides are subsequently 
de-protected and may be purified by precipitation with ethanol, chromatographed using a 
sized or reversed-phase column, denaturing polyacrylamide gel electrophoresis, high- 
pressure liquid chromatography (HPLC), or other suitable method. In addition, within 

20 certain preferred embodiments, a fiinctional group, such as biotin, is incorporated 
preferably at the 5' or 3' terminal nucleotide. A biotinylated oligonucleotide may be 
synthesized using pre-coupled nucleotides, or altematively, biotin may be conjugated to 
the oligonucleotide using standard chemical reactions. Other fiinctional groups, such as 
florescent dyes, radioactive molecules, digoxigenin, and the like, may also be 

25 incorporated. 

Partially-double stranded adaptors are formed from smgle stranded oligonucleotides 
by annealing complementary single-stranded oligonucleotides that are chemically 
synthesized or by enzymatic synthesis. Following synthesis of each strand, the two 
oligonucleotide strands are mixed together in a buffered salt solution {e.g., 1 M NaCl, 
30 1 00 mM Tris-HCl pH.8.0, 1 0 mM EDTA) or in a buffered solution containing Mg"^^ {e.g. 




wo 99/1 0535 PCT/US98/1 7283 

-10- 

10 mM MgCl2) and annealed by heating to high temperature and slow cooling to room 
temperature. 

The oligonucleotide primer that primes first strand DNA synthesis may comprise a 5* 
sequence incapable of hybridizing to a polyA tail of the mRNAs, and a 3* sequence that 
5 . hybridizes to a portion of the polyA tail of the mRNAs and at least one non-polyA 
nucleotide immediately upstream of the polyA tail. The 5* sequence is preferably a 
sufficient length that can serve. as a primer for amplification. The 5' sequence also 
preferably has an average G+C content and does not contain large palindromic sequence; 
some palindromes, such as a recognition sequence for a restriction enzyme, may be 

10 acceptable. Examples of suitable 5' sequences are CTCTCAAGGATCTACCGCT (SEQ 

ID No. ), CAGGGTAGACGACGCTACGC (SEQ ID No. ), and 

TAATACCGCGCCACATAGCA(SEQIDNo. ) 

The 5* sequence is joined to a 3* sequence comprising sequence that hybridizes to a 
portion of the polyA tail of mRNAs and at least one non-polyA nucleotide immediately 

15 upstream. Although the polyA-hybridizing sequence is typically a homopolymer of dT 
or dU, it need only contain a sufficient number of dT or dU bases to hybridize to polyA 
under the conditions employed. Both oligo-dT and oligo-dU primers have been used and 
give comparable results. Thus, other bases may be interspersed or concentrated, as long 
as hybridization is not impeded. Typically, 12 to 18 bases or 12 to 30 bases of dT or dU 

20 will be used. However, as one skilled in the art appreciates, the length need only be 
sufBcient to obtain hybridization. The non-poly A"*" nucleotide is A, C, or G, or a 
nucleotide derivative, such as inosinate. If one non-polyA nucleotide is used, then three 
oligonucleotide primers are needed to hybridize to all mRNAs. If two non-polyA 
nucleotides are used, then 12 primers are needed to hybridize to all mRNAs (AA, AC, 

25 AG, AT, CA, CC, CG, CT, GA, GC, GG, GT). If three non-poly A nucleotides are used 
then 48 primers are needed (3X4X4). Although there is no theoretical upper limit on 
the number of non-polyA nucleotides, practical considerations make the use of one or 
two non-polyA nucleotides preferable. 

For cDNA synthesis, the mRNAs are either subdivided into three (if one non-polyA 

30 nucleotide is used) or 12 (if two non-polyA nucleotides are used) fi"actions, each 



wo 99/10535 PCTAJS98/17283 

-11- 

coniaining a single oligonucleotide primer, or the primers may be pooled and contacted 
with a mRNA preparation. Other subdivisions may alternatively be used. Briefly, first 
strand cDN A is initiated from the oligonucleotide primer by reverse transcriptase 
(RTase). As noted above, RASE may be obtained from numerous sources and protocols 
5 arc well known. Second strand synthesis may be performed by RASE (Gubler and 
Hoffman, Gene 25: 263, 1983), which also has a DNA-directed DNA polymerase 
activity, with or without a specific primer, by DNA polymerase 1 in conjunction with 
RNascI I and DNA ligase, or other equivalent methods. The double-stranded cDNA is 
generally treated by phenolxhloroform extraction and ethanol precipitation to remove 
10 protein and free nucleotides. 

Double-stranded cDNA is subsequently digested with an agent that cleaves in a 
sequence-specific manner. Such cleaving agents include restriction enzymes, chemical 
cleaving agents, triple helix, and any other cleaving agent available. Restriction enzyme 
digestion is preferred; enzymes that are relatively infrequent cutters (e.g., ^ 5 bp 
1 5 recognition site) are preferred and those that leave overhanging ends are especially 

preferred. A restriction enzyme with a six base pair recognition site cuts approximately 
8% of cDNAs, so that approximately 12 such restriction enzymes should be needed to 
digest every cDNA at least once. By using 30 restriction enzymes, digestion of every 
cDNA is assured. 

20 The adapters for use in the present invention are designed such that the two strands 
are only partially complementary and only one of the nucleic acid strands that the adapter 
is ligated to can be amplified. Thus, the adapter is partially double-stranded 
comprising two partially hybridized nucleic acid strands), wherein portions of the two 
strands are non-complementary to each other and portions of the two strands are 

25 complementary to each other. Conceptually, the adapter may be "Y-shaped" or "bubble- 
shaped." When the 5' region is non-paired, the 3' end of other strand cannot be extended 
by a polymerase to make a complementary copy. The ligated adapter can also be blocked 
at the y end to eliminate extension during subsequent amplifications. Blocking groups 
include dideoxynucleotides and other available blocking agents. In this type of adapter 

30 ("Y-shaped"), the non-complementary portion of the upper strand of the adapters is 



wo 99/10535 



PCTAJS98/17283 



-12- 

- preferably a length that can serve as a primer for amplification. As noted above, the non- 
complementary portion of the lower stramd need only be one base, however, a longer 
sequence is preferable (e.g., 3 to 20 bases; 3 to 15 bases; 5 to 15 bases, or 14 to 24 bases. 
The complementary portion of the adapter should be long enough to form a duplex under 
5 conditions of ligation. 

For "bubble-shaped" adapters, the non-complementaiy portion of the upper strands is 
preferably a length that can serve as a primer for amplification. Thus, this portion is 
preferably 15 to 30 bases. Alternatively, the adapter can have a structure similar to the 
Y-shaped adapter, but has a 3' end that contains a moiety that a DNA polymerase cannot 
10 extend fi-om. 

Amplification primers are also used in the present invention. Two different 
amplification steps are performed in the preferred aspect. In the first, the 3' end 
(referenced to mRNA) of double stranded cDNA that has been cleaved and ligated with 
an adapter is amplified. For this amplification, either a single primer or a primer pair is 

1 5 used. The sequence of the single primer comprises at least a portion of the 5' sequence of 
the oligonucleotide primer used for first strand cDNA synthesis. The portion need only 
be long enough to serve as an amplification primer. The primer pair consists of a first 
primer whose sequence comprises at least a portion of the 5' sequence of the 
oligonucleotide primer as described above; and a second primer whose sequence 

20 comprises at least a portion of the sequence of one strand of the adapter in the non- 
complementary portion. The primer will generally contain all the sequence of the non- 
complementary potion, but may contain less of the sequence, especially when the non- 
complementary portion is very long, or more of the sequence, especially when the non- 
complementary portion is very short. In some embodiments, the primer will contain 

25 sequence of the complementary portion, as long as that sequence does not appreciably 
hybridize to the other strand of the adapter under the amplification conditions employed. 
For example, in one embodiment, the primer sequence comprises four bases of the 
complementary region to yield a 1 9 base primer, and amplification cycles are performed 
at 56°C (anneaUng temperature), 72°C (extension temperature), and 94°C (denaturation 

30 temperature). In another embodiment, the primer is 25 bases long and has 1 0 bases of 



wo 99/1 0535 PCT/US98/1 7283 

-13- 

- sequence in the complementary portion. Amplification cycles for this primer are 
performed at 68 °C (annealing and extension temperature) and 94 °C (denaturation 
temperature). By using these longer primers, the specificity of priming is increased. 
The design of the amplification primers will generally follow well-known guidelines, 
5 such as average G-C content, absence of hairpin structures, inability to form primer- 
dimers and the like. At times, however, it will be recognized that deviations from such 
guidelines may be appropriate or desirable. 

In instances where small numbers of cells are available for the initial RNA extraction, 
such as small numbers of stem cells, the preferred method of producing a gene expression 

10 profile comprises the following general steps. Total RNA is extracted from as few as 
5000 stem cells. Using an oUgo-dT primer, double stranded cDNA is synthesized and 
iigated to an adapter in accordance with the present invention. Using adapter primers, the 
cDNA is PGR ampUfied using the protocol of Baskaran and Weissman (1996) Genome 
Research 6(7): 633 and/or Liv et aL (1992) Methods of Enzymology, The original cDNA 

15 is therefore amplified several fold so that a large quantity of this cDNA is available for 
use in the display protocol according to the present invention. For the display, an aliquot 
of this cDNA is incubated with an anchored oligo-dT primer. In one method, this 
mixture is first heat denatured and then allowed to remain at 50^C for 5 minutes to allow 
the anchor nucleotides of the oligo-dT primers to anneal. This provides for the synthesis 

20 of cDNA utilizing Klenow DNA polymerase. The 3 '-end region of the parent cDNA 
(mainly the polyA region) that remains single stranded due to pairing and subsequent 
synthesis of cDNA by the anchored oligo-dT primer at the beginning of the polyA region, 
is removed by the 5 '-3' exonuclease activity of the T4 DNA polymerase. Following 
incubation of the cDNA with T4 DNA polymerase for this purpose, dNTPs are added in 

25 the reaction mixture so that the T4 DNA polymerase initiates synthesis of the DNA over 
the anchored oligo-dT primer carrying the heel. The net result of this protocol is that the 
cDNA with the 3' heel is synthesized for display from the double stranded cDNA as the 
starting material, rather than RNA as the starting material as occurs in conventional 3'- 
end cDNA display protocol. The cDNA carrying the 3 '-end heel is then subjected to 

30 restriction enzyme digestion, ligation, and PGR amplification followed by running the 



wo 99/10535 



PCT/US98/17283 



.14. 

PCR amplified 3 '-end restriction fragments with the Y-shaped adapter on a display gel. 
An allemate method is presented in Example 1. 

After amplification, the lengths of the amplified firagments are determined. Any 
procedure that separates nucleic acids on the basis of size and allows detection or 
5 identification of the nucleic acids is acceptable. Such procedures include slab gel 
electrophoresis, capillary gel electrophoresis, 2-dimensional electrophoresis, high 
performance liquid chromatography, and the like. 

Electrophoresis is technique based on the mobility of DNA in an electric field. 
Negatively charged DNA migrates towards a positive electrode at a rate dependent on 

10 their total charge, size, and shape. Most often, DNA is electrophoresed in agarose or 
polyacrylamide gels. For maximal resolution, polyacrylamide is preferred and for 
maximal linearity, a denaturant, such as urea is present. A typical gel setup uses a 19:1 
mixture of acrylamide:bisacrylamide and a Tris-borate buffer. DNA samples are 
denatured and applied to the gel, which is usually sandwiched between glass plates. A 

1 5 typical procedure can be found in Sambrook et al. {Molecular Cloning: A Laboratory 
Approach, Cold Spring Harbor Press, NY, 1989) or Ausbel et al. (Current Protocols in 
Molecular Biology, Greene Publishing Co., NY, 1995). Variations may be substituted as 
long as sufficient resolution is obtained. 

Capillary electrophoresis (CE) in its various manifestations (fi-ee solution, 

20 isotachophoresis, isoelectric focusing, polyacrylamide get. micellar electrokinetic 
"chromatography") allows high resolution separation of very small sample volumes. 
Briefly, in capillary electrophoresis, a neutral coated capillary, such as a 50 yum X 37 cm 
column (eCAP neutral, Beckman Instruments, CA), is filled with a linear polyacrylamide 
(e.g., 0,2% polyacrylamide), a sample is introduced by high-pressure injection followed 

25 by an injection of running buffer (e.g., IX TBE). The sample is electrophoresed and 

fi-agments are detected. An order of magnitude increase can be achieved with the use of 
capillary electrophoresis. Capillaries may be used in parallel for increased throughput 
(Smith et al. (1990) Nuc. Acids, Res. 1 8:4417; Mathies and Huang (1992) Nature 
359:167). Because of the small sample volume that can be loaded onto a capillary, 

30 sample may be concentrated to increase level of detection. One means of concentration 



wo 99/10535 PCT/US98/17283 

-15- 

- is sample stacking (Chien and Burgi (1992) Anal, Chem 64:489A). In sample stacking, a 
large volume of sample in a low concentration buffer is introduced to the capillary 
column. The capillary is then filled with a buffer of the same composition, but at higher 
concentration, such that when the sample ions reach the capillary buffer with a lower 
5 electric field, they stack into a concentrated zone. Sample stacking can increase detection 
by one to three orders of magnitude. Other methods of concentration, such as 
isotachophoresis, may also be used. 

High-perforaiance liquid chromatography (HPLC) is a chromatographic separation 
technique that separates compounds in solution. HPLC instruments consist of a reservoir 
10 of mobile phase, a pump, an injector, a separation column, and a detector. Compounds 
are separated by injecting an aliquot of the sample mixture onto the column. The 
different components in the mixture pass through the column at different rates due to 
differences in their partitioning behavior between the mobile liquid phase and the 
stationary phase. IP-RO-HPLC on non-porous PS/DVB particles with chemically 
1 5 bonded alkyl chains can also be used to analyze nucleic acid molecules on thq basis of 
size (Huber et al, (1993) Anal Biochem. 121:351; Huber et al. (1993) Nuc, Acids Res, 
21:1061; Huber et al. (1993) fifo/ec/i/zz^Mes 16:898). 

In each of these analysis techniques, the amplified firagments are detected. A variety 
of labels can be used to assist in detection. Such labels include, but are not limited to, 
20 radioactive molecules {e.g., ^^S, ^^P, ^^P), fluorescent molecules, and mass spectrometric 
tags. The labels may be attached to the oligonucleotide primers or to nucleotides that are 
incorporated during DNA synthesis, including amplification. 

Radioactive nucleotides may be obtained firom commercial sources; radioactive 
primers may be readily generated by transfer of label firom y-^^V-ATV to a 5'-OH group 
25 by a kinase (e.g., T4 polynucleotide kinase). Detection systems include autoradiograph, 
phosphor image analysis and the like. 

Fluorescent nucleotides may be obtained firom commercial sources (e.g., ABI, Foster 
city, CA) or generated by chemical reaction using appropriately derivatized dyes. 
Oligonucleotide primers can be labeled, for example, using succinimidyl esters to 
30 conjugate to amine-modified oligonucleotides. A variety efflorescent dyes may be used, 



wo 99/10535 



PCT/US98/17283 



-16- 

- including 6 carboxyfluorescein, other carboxyfluorescein derivatives, carboxyrhodamine 
derivatives, Texas red derivatives, and the like. Detection systems include 
photomultiplier tubes with appropriate wave-length filters for the dyes used. DNA 
sequence analysis systems, such as produced by ABI (Foster City, CA), may be used. 
5 After separation of the amplified cDNA fragments, cDNA fragments which 
correspond to differentially expressed mRNA species are isolated, reamplified and 
sequenced according to standard procedures. For instance, bands corresponding the 
cDNA fi:agments can be cut from the electrophoresis gel, reamplified and subcloned into 
any available vector, including pCRscript using the PGR script cloning kit (Stratagene). 

10 The insert is then sequenced using standard procedures, such as cycle sequencing on an 
ABI sequencer (Foster City, CA). 

An additional means of analysis comprises hybridization of the amplified fragments to 
one or more sets of oligonucleotides immobilized on a solid substrate. Historically, the 
solid substrate is a membrane, such as nitrocellulose or nylon. More recently, the 

1 5 substrate is a silicon wafer or a borosilicate slide. The substrate may be porous (Beattie 
et al. WO 95/1 1755) or solid. Oligonucleotides are synthesized in situ or synthesized 
prior to deposition on the substrate using standard procedures. Various chemistries are 
known for attaching oligonucleotides. Many of these attachment chemistries rely upon 
fimctionalizing oligonucleotides to contain a primary amine group. The oligonucleotides 

20 are arranged in an array form, such that the position of each oligonucleotide sequence can 
be determined. 

The amplified fragments, which are generally labeled according to one of the methods 
described herein, are denatured and applied to the oligonucleotides on the substrate under 
appropriate salt and temperature conditions. In certain embodiments, the conditions are 
25 chosen to favor hybridization of exact complementary matches and disfavor hybridization 
of mismatches. Unhybridized nucleic acids are washed off and the hybridized molecules 
detected, generally both for position and quantity. The detection method will depend 
upon the label used. Radioactive labels, fluorescent labels and mass spectrometry label 
are among the suitable labels. 



wo 99/10535 PCT/US98/17283 

-17- 

The present invention as set forth in the specific embodiments, includes methods to 
identify a therapeutic agent that modulates the expression of at least one stem cell gene 
associated with the differentiation, proliferation and/or survival of stem cells. 

As an example, the method to identify an agent that modulates the expression of at 

5 least one stem cell gene associated v^ith the differentiation of a stem cell population, 
comprises the steps of preparing a first gene expression profile of an undifferentiated 
stem cell population, preparing a second gene expression profile of a stem cell population 
at a defined stage of differentiation, treating said undifferentiated stem cell population 
with the agent, preparing a third gene expression profile of the treated stem cell 
10 population, and comparing the first, second and third gene expression profiles. 

Comparison of the three gene expression profiles for RNA species as represented by 
cDNA firagments that are differentially expressed upon addition of the agent to the 
undifferentiated stem cell population identifies agents that modulate the expression of a 
least one gene in undifferentiated stem cells that is associated with stem cell 

1 5 differentiation. 

While the above methods for identifying a therapeutic agent comprise the comparison 
of gene expression profiles from treated and not-treated stem cells, many other variations 
are immediately envisioned by one of ordinary skill in the art. As an example, as a 
variation of a method to identify a therapeutic agent that modulates the expression of at 

20 least one stem cell gene associated with the differentiation, the second gene expression 
profile of a stem cell population at a defined stage of differentiation and the third gene 
expression profile of the treated stem cell population can each be independently 
normalized using the first gene expression profile prepared firom the undifferentiated 
stem cell population. Normalization of the profiles can easily be achieved by scanning 

25 autoradiographs corresponding to each profile, and subtracting the digitized values 

corresponding to each band on the autoradiograph from undifferentiated stem cells from 
the digitized value for each corresponding band on autoradiographs corresponding to the 
second and third gene expression profiles. After normalization, the second and third gene 
expression profiles can be compared directly to detect cDNA firagments which 



wo 99/10535 



PCT/US98/17283 



-18- 

- correspond to mRNA species which are specifically expressed during differentiation of a 
stem cell population. 

Specific Embodiments 

Example 1 

5 Production of gene expression profiles generated firom cDNAs made with RNA isolated 
firom undifferentiated and partially differentiated stem cells. 
Crude Marrow Preparation 

Expression profiles of RNA expression levels firom undifferentiated stem cells and 
stems cells at various levels of differentiation, including partially differentiated and 

10 terminally differentiated stem cells, offer a powerfiil means of identifying genes whose 
expression levels are associated with stem cell differentiation or proliferation. As an 
example, the production of expression profiles firom murine lineage negative, rhodamine 
low, Hoechst low and rhodamine bright, Hoechst low hematopoietic precursor cells 
allows for the identification of mRNA species and their encoding genes whose 

15 expression levels are associated with stem cell differentiation 

Hoechst'^^'^/Rhodamine**** hematopoietic stem cells were isolated by sacrificing 30 
Balb/c female mice (6-12 weeks) and surgically removing the iliac crests, femurs and 
tibiae. The bones were cleaned and placed in 10 ml PBS/5% HI-FBS on ice. One tube 
was used for the bones firom 10 mice. The bones were ground throughly with a pestle 

20 until completely broken. Following grinding, the supernatant was removed into a 50 ml 
conical tube through a 40 \kM filer(Falcon #2340). 10 ml PBS/FBS was added to the mix 
and the supernatant removed. The supernatant was then centrifiiged (1250 rpm) for 5-10 
minutes. The supernatant which contains a high concentration of lipid was then decanted 
and discarded. 

25 The cells were then pooled into 25 or 50 ml firesh PBS/FBS, and tiny bone fi-agments 
removed by settling. The cells were then counted in crystal violet. Cells were diluted 
and underlayed with LSM, centrifiiged at 2000rpm(1000xg) for 20 minutes. To harvest 
the buffy coat, the supematant was removed to within 1 cm of the cells. The next 8- 



wo 99/10535 PCT/US98/17283 

-19- 

- 10ml of medium and cells were harvested by swirling the media around in the tube to 
draw cells from all sides of the gradient. The cell volume was then brought up to 50 ml 
with PBS/FBS and spun at 1400rpm 5-10 minutes. 



Lineage Depletion 

5 Cells were counted in Crystal Violet and resuspended in fresh PBS/FBS. Lineage- 
specific antibodies were added as follows: 

TER 119 0.1 Jig/ml final concentration 
B220 15^iyi0* cells 

Mac-1 15nl/10^ cells. 

10 Gr-1 15^ylO« cells 

Lyt-2 1/20 final dilution ^ 

L3T4 1/20 final dilution 

Yw25.12.7 1/100 final dilution 

The cells were incubated on ice for 15 minutes, brought to a volume of 50ml with 
15 PBS/FBS and collected at 1400rpm for 5-10 minutes, and washed to remove unbound 
antibodies. 

During the antibody binding step. Magnetic Beads(Dynabeads M-450) were prepared at a 
ratio of 5 beads/cell. The beads were coated with Sheep anti-Rat antibodies that bind to 
the lineage-specific antibodies, which are all of rat origin. When the beads are placed in 
20 a magnetic field, the Lin* cells are removed. The resulting supernatant contains the Lin" 
population (granulocytes and lymphocyte populations will be substantially depleted or 
absent after this step.) 

Hoechst/Rhodamine Staining 

Rhodamine 123 was added to a final concentration of 0. 1 |ig/ml, then incubated at 
25 32°C for 20 minutes in the dark. Without fiirther manipulation or washing, HOECHST 
33342 was added to a final concentration of lO^M then incubated at 37 °C for an 
additional hour. The aliquot of crude mairow was brought to 0.5 ml with PBS/FBS and 
Hoechst to this cell preparation as well. The volume was brought to 50 ml with 
PBS/FBS, centrifixged at HOOrpm for 5-10 minutes, supernatant discarded and cells 
30 resuspended to 2x10^ cells/ml. The rhodamine only and Hoechst Only/Crude Marrow 



wo 99/10535 



PCT/US98/17283 



-20- 

were washed in parallel. These two populations were then resuspended in 0.5ml 
PBS/FBS for flow cytometry analysis 

Total RNA was extracted from approximately 5000 stem cells. Using an oligo-dT 
primer, double stranded cDNA is synthesized and ligated to an adapter in accordance 
5 with the present invention. Using adapter primers, the cDNA is PGR amplified using the 
protocol of Baskaran and Weissman (1996) Genome Research 6(7): 633 and Lie et aL, 

Methods of Enzymology, . The original cDNA is therefore amplified several fold so 

that a large quantity of this cDNA is available for use in the display protocol according to 
the present invention. 
10 Synthesis of cDNA for the gene expression profiles was perfomied as below: 

Materials and Reagents 

A microPoly(A)Pure mRNA Isolation kit (Ambion Inc.) was used for mRNA isolation. 
All the reagents for cDNA synthesis were obtained from Life Technologies Inc. Klentaql 
DNA polymerase (25U/a^1) was from Ab peptides Inc. Native Pfu DNA polymerase 

15 (2.5U//^1) was purchased from Stratagene Inc. Betaine monbhydrate was from Fluka 
BioChemica and dimethylsulfoxide (DMSO) was from Sigma Chemical Company, 
Deoxynucleoside triphophates (dNTPs, lOOmM) and bovine serum albumin (BSA, 10 
ihg/m!) were purchased from New England Biolabs, Inc. Qiaquick PGR purification kit 
(Qiagen) was used to purify the amplified PGR products. The oligonucleotides used in the 

20 Examples were synthesized and gel purified in the DNA synthesis laboratory (Department 
of Pathology, Yale University School of Medicine, New Haven, CT). 



Table L Sequences of oligonucleotides. 



T7-SalI-oligo-d(T)V 


5'-ACG TAA TAG GAC TCA CTA TAG GGC GAA TTG GGT CGA C- 
d (T) ,8 V-3 ' , where V = A, C, G 


anti-NotI Long 


5'-CTT ACA GCG GGC GGT TGG ACG-3' 



wo 99/10535 



PCT/US98/17283 



-21- 



NotI Short 


5'-AGC GGC CGC TGT AAG-3' 


Notl/RI primer 


5'-GCG GAA TTC COT CCA AGC GGC CGC TGT AAG-3' 



Methods 

L Preparation of mRNA 

5 MicroPoly(A)Piire mRNA isolation kit was used for the isolation of Poly(A)^ RNA 
following the kit instructions. mRNA from a small number of mouse hematopoietic cells 
(5,000-10,000 cells) was extracted, eluted from the colimm, and precipitated by adding 0.1 
volume of 5M ammonium acetate and 2.5 volumes of chilled ethanol with 2/2g glycogen as 
carrier. The tubes were left at -20'*C overnight. The pellets were collected by centrifugation 
10 at top speed for 30 minutes, washed with 70% etiianol and air-dried at room temperature. 
The pellets were resuspended in 10;zl HjO/O.lmM EDTA solution. We observed that the 
dissolved mRNA solution was cloudy due to the leaching of column materials, therefore the 
samples were centrifuged at 4** C for 5 minutes. The supernatant was collected for further 
use. 

15 n. cDNA synthesis 

First strand cDNA synthesis 

The cDNA synthesis reaction (final reaction volimie is 20/il) was carried out as 
described in the instruction manual (Superscript Choice System) provided by Life 
Technologies Inc. For the first strand cDNA synthesis, mRNA (lOyul) isolated from a small 
20 number of ceUs was annealed with 200ng (1/il) of T7-SalI-oligo-d(T)V-primer (see Table- 1 ) 
in a 0.5-ml micro centrifuge tube (no stick, USA Scientific Plastics) by heating the tubes at 
65**C for 5 minutes, followed by quick chilling on ice for 5 minutes. This step was repeated 



wo 99/10535 



PCT/US98/17283 



-22- 

- once and the contents were collected at the bottom of the tube by a brief centrifugation. The 
following components were added to the primer annealed mRNA on ice prior to initiating 
the reaction, l^^l of lOmM dNTPs, 4/zl of 5 x first strand buffer [250mM Tris-HCl (pH 8.3), 
375mM KCl, 15mM MgCy, 2^1 of lOOmM DTT and lju] of RNase Inhibitor (4OU//2I). All 
5 the contents were mixed gently and the tubes were pre-warmed at 45°C for 2 minutes. The 
cDNA synthesis was initiated by adding 200 units (1//1) of Superscript II Reverse 
Transcriptase and the incubation continued at 45°C for 1 hour. 



Second strand cDNA synthesis 

At the end of first strand cDNA synthesis, the tubes were kept on ice. Second 

10 strand cDNA synthesis reaction (final volume is 150/^1) was set up in the same tube on 
ice by adding 91/^1 of nuclease fi-ee water, 30/A of 5x second strand buffer [lOOmM 
Tris-HCl (pH 6.9), 23niM MgCl^, 450mM KCI, 0.75mM (p-NAD* and 50mM 
ammoniimi sulfate], 3/^1 of lOmM dNTPs, 1/^1 of£'.co// DNA ligase (lOU/^^l), 4/^1 of 
E,coli DNA polymerase I (10U///1) and l^^l of E.coli RNase H (2U//zl). The contents were 

15 mixed gently and the tubes were incubated at 16°C for 2 hours. Following the incubation, 
the tubes were kept on ice, 2^1 of T4 DNA polymerase (3U///1) was added and the 
incubation was continued for another 5 minutes at 16°C. The reaction was stopped by the 
addition of lOyul of 0.5M EDTA (pH 8.0) and extracted once with equal volume of 
phenol: chloroform 1:1 (v/v) and once with chloroform. The aqueous phase was then 

20 transferred to a new tube and precipitated by adding 0.5 volumes of 7.5M ammonium 
acetate (pH 7.6), 2/^g of glycogen (as carrier) and 2.5 volumes of chilled ethanol. The 
samples were left at -20°C for overnight and the cDNA pellets were collected by 
centrifugation at top speed for 20 minutes. The pellets were washed once with 70% 
ethanol, air-dried and dissolved in 14^^1 of nuclease free water, 

25 As the amount of cDNA derived from a small number of cells may be low, it may 

be necessary to amplify the cDNA for further analysis. To uniformly amplify the cDNA, 
an adaptor (NotI adaptor) was first ligated to both ends of the cDNA. Following adaptor 



wo 99/10535 



PCTAJS98/17283 



-23- 

ligation, the cDNAs were amplified with Notl/RI primer (see table J), by a modified 
PCR method using betaine and DMSO. 

Ligation of cDNA with NotI adaptor 

Preparation of NotI adaptor: The NotI adaptor was prepared by annealing 
Notl-short and anti-Notl-long oligonucleotides (see Table 1). The anti-Nofl-long 
oligonucleotide was phosphorylated to ensure that both the adaptor oligonucleotides are 
ligated to the cDNA. \fxg of anti-Notl-long was mixed with 1^1 of lOx T4 polynucleotide 
kinase buffer [700mM Tris-HCl (pH 7.6), lOOmM MgClj and 50mM DTT], 1/^1 of 
lOmM adenosine triphosphate (ATP), adjusted the volume to 9^1 with water and the 
reaction was initiated by adding 1^1 of T4 polynucleotide kinase (IOU/aiI). The tubes were 
incubated at 37 °C for 30 minutes and then the enzyme was inactivated at 65 °C for 20 
minutes. The annealing was carried out by adding the following components to the above 
phosphorylated anti-Notl-long: 1 ^g of Notl-short, 2^1 of lOx oligo annealing buffer 
[lOOmM Tris-HCl (pH 8.0), lOmM EDTA (pH 8.0) and IM NaCl] and water to adjust 
the final volume to 20^1. The sample was heated at 65°C for 10 minutes and allowed to 
cool down to room temperature. The annealed adaptor was stored at -20 °C. 

Ligation ofcDNA with annealed NotI adaptor : To set up this reaction, 
1 4Ail of cDNA was mixed with 1 OOng of annealed NotI adaptor in a 0.5-ml micro 
centrifuge tube. To this mixture 2^1 of IQx T4 DNA ligase buffer [500mM Tris-HCl (pH 
7.8), lOOmM MgCli, lOOmM DDT, lOmM ATP and 250mg/ml BSA] was added and 
adjusted the volume with water to 18/zl and mixed gently. The reaction was initiated by 
adding 2^1 of T4 DNA ligase (400U//zl) and incubated at 1 6 " C overnight. 

m. cDNA amplification 

A modified betaine-DMSO PCR method (Baskaran et al. (1996)) Genome 
25 Research 6:633) was used to uniformly amplify the cDNA with different GC content. 
This method uses the LA system, which combines a highly thermostable form of Tag 
DNA polymerase (Klentaql, which is devoid of 5'-exonuclease activity) and a 
proofi-eading enzyme {Pfu DNA polymerase, which has 3'-exonuclease activity). The 



wo 99/10535 



PCT/US98/17283 



-24- 

- LAI 6 en2yme consists of 1 part of Pfu DNA polymerase and 1 5 parts of KlenTaql DNA 
Polymerase (v/v). The NotI adaptor-ligated cDNA was diluted 10 fold with water. 2 of 
this diluted cDNA was used as the template for PGR. The PGR reaction (50/^1 final 
volume) was set up with the following components: of lOx PGR buffer [200mM 
5 Tris-HGl (pH 9.0), 160mM ammonium sulfate and 25mM MgCIj], l6fA of water, 0.8//1 
of BSA (IQmg/ml), l/zl of Notl/RI PGR primer (lOOng/ul), 5/^1 of 50% DMSO (v/v), \5}x\ 
of 5M Betaine and 0.2^1 of LAI 6 enzyme. These components were mixed gently on ice 
and then heated to 95^G for 15 seconds on a PGR machine, and held at 80°C while 5//I of 
2mM dNTPs were added to start the reaction. The PGR conditions were as follows: Stage 

10 7; 95°G for 15 seconds, 55°C for 1 minute, 68°G for 5 minutes, 5 cycles. Stage 2: 95*'G 
for 15 seconds, 60 °G for 1 minute, 68 °G for 5 minutes, 15 cycles. 

After amplification, cDNA was purified with the Qiaquick PGR purification kit 
(following the instructions provided by the supplier). The purified cDNA was eluted in 
the desired volume of water. 

15 Gene expression profiles were prepared from the purified cDNA as previously 

described by Prashar et al in WO 97/05286 and in Prashar et al (1996) Proc, Natl Acad. 
ScL USA 93:659-663. Briefly, the adapter oligonucleotide sequences were 
GTTAGAGCGGGGGGTTGGAGG, GAATGTGGGGGGGGA or alternatively, 
Al (TAGGGTGGGGGGGAGGGAGGGGGAG) and 

20 A2 (GATGCTGGGCGTGGGGTGTGTGTGGGGGG). When A1/A2 were used, one 
microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 
polynucleotide kinase (PNK). After phosphorylation, PNK was heated denatured, and 
lA^g of the oligonucleotide Al was added along with lOx annealing buffer (1 M 
NaGl/100 mM Tris-HGl, pH8.0/10 mM EDTA, pH8.0) in a final vol of 20 /^L This 

25 mixture was then heated at 65°G for 10 min followed by slow cooling to room 

temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 
100 ng/^l About 20 ng of the cDNA was digested with 4 units of a restriction enzyme 
such as C/al, Bgl II, etc. in a final vol of 10 /^l for 30 min at 37°G. Two microliters (=4 
ng of digested cDNA) of this reaction mixture was then used for ligation to 100 ng (=50- 

30 fold) of the Y-shaped adapter in a final vol of 5/^1 for 16 hr at IS'^G. After Ugation, the 



wo 99/10535 



PCTAJS98/17283 



-25- 

- reaction mixture was diluted with water to a final vol of 80 pil (adapter ligated cDNA 
concentration, =50 pg/A*!) and heated at 65 "C for 10 min to denature T4 DNA Ugase, and 
2-pl\ aliquots (with =100 pg of cDNA) were used for PGR. 

The following sets of primers were used for PGR amplification of the adapter 
5 ligated 3 ' -end cDNAs: GGGGAATTGGGTGGAAGGGGCGGGTGTAAG or 
alternatively, RP 5.0 (CTCTCAAGGATCTTACCGCTT .gAT), RP 6.0 
(TAATACCGCGCCACATAGCAT igCG). orRP 9.2 

(CAGGGTAGACGACGCTACGCTigGA) were used as 3' primer while Al.l 
(TAGCGTCCGGCGCAGCGAC) served as the 5' primer. To detect the PGR products 

10 on the display gel, 24 pmol of oligonucleotide Al.l was 5' -end-labeled using 15 /zl of 
[Y-^^ P]ATP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 /ul for 30 min 
at 37°C. After heat denaturing PNK at 65°C for 20 min, the labeled oligonucleotide was 
diluted to a final concentration of 2 fjM in 80 /zl with unlabeled oligonucleotide Al.l. 
The PGR mixture (20/^1) consisted of 2 /zl (=100 pg) of the template, 2fxl of lOx PGR 

15 buffer (100 mM Tris-HCl, pH 8.3/500 mM KCl), 2 a^I of 1 5 mM MgClz to yield 1 .5 mM 
final Mg^* concentration optimum in the reaction mixture, 200 fxM dNTPs, 200 nM each 
5' and 3' PGR primers, and 1 unit of Amplitaq. Primers and dNTPs were added after 
preheating the reaction mixture containing the rest of the components at 85*'C. This "hot 
start" PGR was done to avoid artefactual amplification arising out of arbitrary annealing 

20 of PGR primers at lower temperature during transition firom room temperature to 94°C in 
the first PGR cycle. PGR consisted of 28-30 cycles of 94°C for 30 sec, 50''C for 2 min, 
arid 72 "C for 30 sec. A higher number of cycles resulted in smeary gel patterns. PGR 
products (2.5Afl) were analyzed on 6% polyacrylamide sequencing gel. For double or 
multiple digestion following adapter Ugation, 13.2 ^1 of the ligated cDNA sample was 

25 digested with a secondary restriction en2yme(s) in a final vol of 20 ;zl. From this 

solution, 3 Ail was used as template for PGR. This template vol of 3 Atl carried = 100 pg 
of the cDNA and 10 mM MgClj (from the lOx enzyme buffer), which diluted to the 
optimum of 1 .5 mM in the final PGR vol of 20 fA. Since Mg^* comes from the 
restriction enzyme buffer, it was not included in the reaction mixture when amplifying 
30 secondarily cut cDNA. Bands may then be extracted from the display gels as described 



wo 99/10535 



PCT/US98/17283 



-26- 

by Liang ei ai (1995 Curr. Opin^ Immunol 7:!274-280), reamplified using the 5' and 3' 
primers, and subcloned into pCR-Script with high efficiency using the PCR-Script 
cloning kit from Stratagene. Plasmids were sequenced by cycle sequencing on an ABI 
automated sequencer. 

5 Figure 1 presents an autoradiogram of the gene expression profiles generated 

' from cDN As made with RNA isolated from Lin% LRH, LRH48 and LRBRH cells. All 
possible 12 anchoring oligo d(T)nl, n2 were used to generate a complete expression 
profile for the enzyme C/al. 

Tabic 2 presents the sequences of numerous differentially expressed bands from 
10 expression profiles made from LIN^ LRH, LRH48 and LRBRH. 



TABLE 2 



HSC-DD-006 


TTTAATTAGCGCTCTATATACATTGCG 

GAACTTCCCCCGACTGCAGCAGTTTGA 

CTTTGGCACAACATCAAGTTCCATTTC 

TTTTGGACATTGGATTCTGTTTTGANA 

GTATGTATGCCCCAAAGCA'ri'nCAGT 

GTCATCAGGATTAGTTGGGCCCATTCA . 

CAGTAATTCANANATC 


HSC-DD-285 


TAGAATACCTGGATGGCTTCTCTTGTC 

CACCCGATCTCCCGTGTTACCAATGTG 

TATGGTCTCCTTCTCCCGAAAGTGTAC 

TTAATCTTTGCTTTCTTTGCACAATGTC 

TTTGGTTGCAAGTCATAAGCCTGAGGC 

AAATAAAATTCC 



wo 99/10535 PCT/US98/17283 



-27- 



HSC-DD-007B 


GATCTGGCTAGACAGTTATTCTGAACT 

ATGGCTTCAAGATGAACAAGACAAGC 

CTAAAAGGATGGAGAGAGGCAATGGA 

GATAATGTTTTGGAGGAAGTATGTCAC 

TCAAGCATGAACTCTGTTTATTTAGAA 

ATGAGATTCCATATATGTGGTACATGT 

GGAAAGAATCTAAAAAGTCCTTTAAA 

TTTTTTCATTCCAAAAG 


HSC-DD-238 


CTNNANNAGCACTCTTCTTGGCCAGAC 

CTCTGTCCAAGGCTCATTAGAAAGCTG 

GGGTTNTGTNCACGTNACNNACTTNAT 

CNAAACTNTTGCTGTNTTGGCATAAGT 

TGTGTNTCTGGACTGTNNTGTATTCCC 

CTCTAGACAAAGGANGAACNNAAAAG 

TNNTTGCNNNCTTTNCCAGAACATNCT 

CAAAGCCTNTGATGGAGGAGCACAAG 

GACCCTGTCTGCTGAGGGCCCATGGNT 

CCTCTCAGGGGTTTCTNCCCACCNAGG 

CAGTGCCTTCATTNGCTAGTNGTNCAG 

TTACTTGTAGNTTATCTTTNAATAAAT 

TTNAATAAAANCTA 


HSC-DD-206 


CTAGATTGTGTGGTTTGCCTCATTGTG 
CTATTTGCGCACTTTCCTTCCCTGAAG 
AAATANCTGTGAANCTTCTTTCTGTTC 
AGTCCTAANATTCNAAATANAGTGAG 
ACTATG 



wo 99/10535 



PCTAJS98/17283 



-28- 



HSC-DD-214 


CTCAAGNACGGGCCAGGTAAGGGCCT 

TTAACACAACTAAATCAAGGTGTGCTT 

NCCTCCGGGTTCTATGCAAGCAAGGCA 

TACACACTGCACTCTCNCNCTCNCTAA 

ACTGGAAANGTACAGTNGCAGGGCTG 

GTTTCAGACNACGTGATGCNTGTTTAC 

AAAC 


HSC-DD-035 


TTTTTATTCAATATATTAAATATATTAA 

TCAGAAAAGTCACATCCTATAAATCCA 

GGAAAATACACAAATATAAATCAGAA 

TCTGTCAATCACCTTCTTGAGTGACAG 

TTATGTACACATGGAAGGAGAGCGGA 

AGAGATC 


HSC-DD-129 


CGATATACACCATCGGTCTGGGGCCAA 

CGCTAATACTACTTGGTGCTGCCAATT 

GAATTCTGGTTTGCTGTGAATCTCTAT 

CAACAAGAGTATCATTTGTGAATGCTT 

TAATTTATTGAGAAAGAACAAGAAGA 

TGATGGATACATTGATACATTTGCGCA 

GCCTTGCAGCCTGACTCAATTCTGCTG 

TTCATCAGTTTTAATGTCCTTTCTGTGT 

CATACGTG 



wo 99/10535 PCT/US98/I7283 



-29- 



HSC-DD-040 


GATCtTTTTTCCTTCACTTATTGCTGAA 
APr A ArJNnrArAATTCCCATTAAGNG 
AAGGATCTCTGTGCTGTAAACTAAACA 
AATTGTGCATTTTTTCTGGGGCCATTG 
TTTTTGGTTTATTTTGTTATTTTGTTTTG 
TTTTTGTTTTTTTGGTTTCATTTTG 1 IIT 
GGGTTGGTCCAATTTTAAAAGGAAATA 
CTACAATAAAAATGTTA 


HSC-DD-011 


GATrTGATTTGCTAGTTCTTCCTGGTA 

GAGTTATAAATGGAAAGATTACACTAT 

CTGATTAATAGTTTCTTCATACTCTGC 

ATATAATTTGTGGCTGCAGAATATTGT 

AATTTGTTGCACACTATGTAACAAAAC 

TGAAGATATGTTTAATAAATATTGTAC 

T 


HSC-DD-121 


ncn/i^ TOTTPTTPT A PTr* A P A ACTC ACG 

TTGGTGGCCTGGGCCTGAACTTGACTG 

GAGCTGACACTGTGGTGTTTGTGGAGC 

ATGACTGGAACCCTATGCGAGATCTGC 

AGGCCATGGACCGGGCCCATCGTATTG 

GGCAGAAACGTGTGGTTAATGTCTACC 

GGTTGATAACCAGA 


HSC-DD-015B 


GATCTGGAAGGGAATGTCCAAAGAGA 
AGAAGGAGGAGTGGGACCGCAAGGCT 
GAGGATGCTAGGAGGGAGTATGAGAA 
AGCCATGAAAGAGTATGAAGGAGGAA 
GAGGGGACTCATCTAAAAG 



wo 99/10535 



PCTAJS98/17283 



-30- 



HSC-DD-039 


GATCTTCGACACAGAGAAGGAGAAAT 

ACGAGATTACAGAGCAGCGAAAGGCT 

GACCAGAAAGCTGTGGATTTGCAGATT 

TTGCCAAAGATTAAAGCTGTTCCTC AG 

CTCCAGGGCTACCTGCGCTCTCAGTTT 

TCCCTGACAAACGGGATGTATCCTCAC 

AAACTGGTCTTCTAAATTGTTAACCTA 

ATTAAACAG 


HSC-DD-042 


ACTC AATCTCTTCAAACTCTTTATACT ■. 

GGNCTATNATNAGNGGGGATGTGNCA 

ANATNGACNCTGGTGGTGTATGAAAG 

AAAAGNTCNATGGACNTNGGCATNCC 

AAGATTGAATTC ACCTGCTTCCTACGA 

TGTGTGAAACTGCTAATAGCAAAATAT 

CTCTANGGTTATGANGAGTACTGTCGT 

TCTGCAAATATTCACTTCANAACTANN 

CACCACGTTNAA 


HSC-DD-256A 


ctagataatcccttActgagtctttctt 

cncaggtgattcanttgagttgacaat 

tannnctaagaattcaatggactant 

gaggtgcctcagcagntaatagcant 

tgctgttcttccagaggaccagagttc 

agtttctcatcccaagttgggctgctc 

gtnagtgtcggtaantccagcttcagg 

ggcttgaatttatactgaccatgggca 

cctgtaccccaacacanacacataca 

CAT 



wo 99/10535 



PCTAJS98/17283 



-31- 



HSC-DD-256B 


CTAGAAGTTAATCCTGTNAAGCATGGT 

AAGAATANCATTCTCAANATCTTGAGT 

TAANAAAGATCTTGGAGGNGGCTGGN 

GAGATGGCTCANTGGTTAAGANCNCT 

GACTGCTCTTCCAGAGGTCCTGANTTC 

AATTCCCANCAACCACATGGTGGNTCA 

CAACCANCTGTAATGATACCTGATGCC 

ATCNTCCGTGGTGTATCTGAANACANC 

TACAGTGACAGCTACANCG 


HSC-DD-045 


GGATTTTATTCTAGGCTTGGCCAGATA 

CAGGTTGGCATCCTAGGGGAGGAAGA 

TAACAATGTCATAGGTGAATTTGTTAG 

GAGAGGCAAGACATGGGAAATCATTG 

ATTTCTTC AGATTTCTTT AAAGC AAAT 

TAGAAGATAAATGTCTAAAAGAGATA 

CACTTAAAAAATGGTGAAACTATAAC 

CCCTTAAGGAGAGCCAGATGTGGCAG 

GAGCCAGGTCTGAAAATGGTAGCTGA 

AGTAAGCAGACCAGCGTAAGATC 


HSC-DD-068 


CGATGAGTCAGAGAGGAAGTGGACAG 
TGCGTTATTCATTACAGCAAAGGATTT 
CGTTGGCATCAAAATCTAAGTTTGTTT 
TACAAAGATTGTTTTTAGTACTAAGCT 
GCCTTGGCAGTTTGCATTTTTGAGCCA 
AACAAAAATATATTATTTTC 



wo 99/10535 PCTAJS98/17283 



-32- 



HSC-DD-143 


CGATTCAATTGTATAAATGATTATAAT 

TTCTTTCATGGAAGCATGATCCTTCTG 

ATTAAGAACTGTACCCCATATTTTATG 

CTGGTTGTCTGCAAGCTTGTGCGATGA 

TGTTATGTTCATGTTAATCCTATTTGTA 

AAATGAAGTGTTCCTGACCTTATGTTA 

AAAAGAGAGAAGTAAATAACAGACAT 

TATTCAGTTATTTTGTCCTTTATCGAAA 

AACCAGATTTCATTTTTCCTTTTTGTTT 

GTGATCTCATTTGGAAATAATTGGCAA 

GTTGAGGTACTTTCTTCCCATGCTTTGT 

ACAATATAAACTGTTATGCCTTTCAGT 

GCGTTACTGTGGG 










HSC-DD-263A 


CTAGAGGTGGGAACTGGCTCCACTCCA 

CACAGCAGCCAGTTAGTTAGTGACGGT 

CAGCTGCATGCAGGGGAATGAAGGAC 

TCGGAGAGAACGTTCTGTGCTATGTGT 

GTTCCATAGAGATTAAAAAGGAGGCC 

TGGAGCCGAGCATGGTGGTGCACGCC 

TTTAATCCCAGCACTTGGGAGGCAGAG 

TCAGGTGGATTTCTGAGTTCATTGCCA 

GCCTGGTCTACAGAGTGAATTCCAGGA 

CAGGCAGGGCTACACAGAGAAACCCT 

GTCTCAAAAAA 


HSC-DD-263B 


CTAGAATTTGCAGTAGCATTAATTCAA 
GCCTACGTATTCACCCTCCTAGTAAGC 
CTATATCTACAT 



wo 99/10535 



PCT/US98/17283 



-33- 



HSC-DD-239A1 


CTAGACATAAGATATTGTACATAAAG 1 

ANAATTTTTTTTGCCTTTAAATAGATA 

AAAGTATCTATCAGATAAAAATCANG 

TTGTAAGTTATATTGAAGACAATTTGA 

TACATAATAAAAGAT 


HSC-DD-239A1' 


GGGGAGNNNNCNAGNAANNAGANTC 

GTACGTAAANAGAANNNTGGTGCNTT 

TANATAGAAAANGTACTATCANATAA 

NAATCAGGTTGTAAGTTATATTGAAGA 

CGNTTTGATACATAATAAAAGAT 


HSC-DD-261 


CTAGACTGACAAAGACTTTTTGTCAAC 
TTGTACAATCTGAAGCAATGTCTGGCC 
CACAGACAGCTGAGCTGTAAACAAAT 
GTCACATGGAAATAAATACTTTATe 


HSC-DD-028A 


CTCTCTTGCCACCCAGATGGTTAGGAT 1 

GATTCTGAAGATGATGACATCCGTAAG 

CCTGGAGAATCTGAAGAATAAACTGT 

ACCAT 


HSC-DD-021 


ATCTCTGGCAGGTCAAGTCTGGGACAA 
TCTTTGACAATTTCCTCATCACCAGTG 
ATGAGGCCTATGCAGCCAGTTCTAGCG 
CAGGTCACACTGAGAGTGTAAGAACT 
ACGAACAAAATNTCTATTAAATTAAG | 



• 



wo 99/10535 PCT/US98/17283 



-34- 



HSC-DD-025 


GATCTCGGAATGGACCCAACTGCTCCT 

GCTCCACCGGCGGCTCCTGCACTTGCA 

CCAGCTCCTGCGCCTGCAAGAACTGCA 

AGTGCACCTCCTGCAAGAAGAGCTGCT 

GCTCCTGCTGTCCCGTGGGCTGCTCCA 

AATGTGCCCAGGGCTGTGTCTGCAAAG 

GCGCCGCGGACAAGTGCACGTGCTGT 

GCCTGATGTGACGAACAGCGCTGCCA. 

CCACGTGTAAATAGTATCGGACCAACC 

CAGCGTCTTCCTATACAGTTCCACCCT 

GTTTACTAAACCCCCGTTTTCTACCGA 

GTACGTGAATAATAAAAGCCT 


HSC-DD-077 


ATTCAGACGAATGAGAerCCTCCACAT 
TGGAGACAAGAGATGCAGAGAGCTCA 
GAGAATGAGGGTGTCAAGTGGTGAAA 
GATGGATCAAAGGGGATAAGAGTGAG 
TTAAATGAAATAAAAGAAAATCAAAG 
GAGCC 


HSC-DD-245 


NGCNNNNNNNCCAGNAGGAGGAGAA 

GATGACTGGCCAGTATCANAATGGGA 

TAAGATGAGGCGCGCCCTGGAGTACA 

CCATCTACAACCAGGAGCTCAACGAG 

ACGCGCGCTAAGCTCGACGAGCTTTCT 

GCTAANCGAGAAACNAGTGGAGAGAA 

ATCCNGACAACTAAGGGATGCCCAGC 

AGGATGCANGAGACAAAATGGAGGAT 

ATTGAGCGCCAGGTTAGAGAACTGAA 

AACAATNAT 



wo 99/10535 



PCT/US98/17283 



-35- 



HSC-DD-226 


eTCAAGGAAAAGACAGCAGGNCGTGG 

CTGGCATCTGNTGNNTTAGNTNATNTN 

NAANTNTCNNNTNGNCCTGGCAACGG 

TTCCTGAACNAATTACCACTCCTTCTT 

GCCAGTCNAANAGGGTGGGAAAGTCC 

GAGCCTTANGACCCAGTTTCAGTTCTG 

GTTTCTTCCCTCCTGANCACCATCGGT 

TGTTAGTTGCCTTGAGTTGGGAACGTT 

TGCATCGACACCTGTAAATGTATTCAT 

TCirTAATTTATGTAAGGTTTTNTGTNC 

TCAATTCTTTAAGAAATGACAAATTTT 

GGTTTTCTACTGTTCAATGAGAACATT 

AGGCCCCAGCAACACGTCATTGTGTAA 

ANAAATAAAA 


HSC-DD-182 


CGATGGCTCCATCCTGGCCTCACTGTC 

CACCTTCCAGCAGATCGGCTCAGCAAG 

CAGGAGTAGGATGAGTCTGGCCCCTCC 

ATCGTGC ACCGCAAATGCTTCTAGGCG 

GACTGTTTTACACCCTTTCTTTGACAA 

AACC 




wo 99/10535 PCT/US98/17283 



-36- 



HSC-DD-089 


CNNATGCTACATGCTGNAGGATGCCTA 




AGGCTGCCCCCCACCATCCCCTGGCTC 




TGCTGNCCGGANCAAATTGCTTCCAGA 




TGTGACTTTGGAACCTTCNCACCCCTN 




ACCCNACCNNTCTC^^AGAANOTCTTTT 




ATTTAAAGGAGGAAANANNACATCCA 




AGAAAANGGGGGGAGGGGGGATGGA 




AANNCGCATCCCCTTTCTAGCCAGCTG 




TTCCCAAAAGGTACCCTTCCTCTCTGC 




TGCTCCCCAAACNCAAANCCCACTTCN 




GANCCTCCACCTAAANCATCANGCAA 




GTCACNTACACCCTGTTTANCCCCCNA 




CTCTCTGCTTATACCCNGGAACAATTN 




NTGCTCG 



wo 99/10535 



PCT/US98/17283 



-37- 



HSC-DD-151 


CGATGGTGGGGATCTTACTGGGGAAG 

AGGAAGGACCATTAGCACACCATCAT 

GATGTCAGATGACAAAATGGAAGCCA 

AGACACCTTGAAGGTGACTTTCTAGGA 

AGGTCTTAAGCATGTAATGTCCCTTTA 

TCAGAGGGAAGGGGACAAACTCAGGG 

CAGCCCTGTCCAGGTAGAAATATTTTT 

GCCCCCCTGTCTGATGTTGATGAGGGG 

TCATACCANCCAGGGAGACCCTCTGG 

GAGGAAGCTGCCACACACAANGACTC 

TGGAAGTATCCAGATGTGAGCCCAGC 

CAGGGTCCTATGGTTCCAAATCTGAAN 

AAAAGGTTTTTC AC AC ACTCCTTGCTT 

TCTGCTAAGATAANAAAGGCGTCACTC 

TGCCAGAGTGTGACTTTTTACAGATJA 

AATAAAGCTGTTAT 


HSC-DD-013 


GATCTACTCCATTCCCCTGGAAATCAT 

GCAGGGCACCGGGGGTGAGCTGTTTG 

ATCACATTGTCTCCTGCATCTCCGACT 

TCCTGGACTACATGGGGATCAAAGGC 

CCCGGATGCCTCTGGGCTTCACCTTCT 

CGTTTCCCTGCAAGCAGACGAGCCTAT 

ATTGCGGAATCTTGATCACGTGGACAA 

AGGGATTCAAAGCCACCGACTGTGTG 

GGTCACNATGTANCCACTTTACTGAG 


HSC-DD-029 


GATCTGAGTTCGAGGCCAGCCTGGTCT 
ACAGAGTGAGTTCCAGGNCAGCCAGG 
NCTACACAGAGAAACCCTGTCTCGAA 
AAAACAGAAAGAGA 



wo 99/10535 



PCT/US98/17283 



-38- 



HSC-DD-034 


CTTTCATTAAAAAGAAACCAGGGGCT 

GGANAGATGGCTCAGTGGTTAAGAGC 

ACCAACTGCTCTTCCCGAAGGTCCTAA 

GTTCAAATCCCAGCAACCACATGGTGG 

CTAACAACCACTCGTAATGAGATC 


HSC-DD-082B 


ATCGCNTGGCTCTCCTGNGGCCTGGCN 

TACGACNNGAAAAGGAGTGTCCACGG 

CTGCTGTCGNGGCCACGATTAATTAAA 

ACTGAAGTACCGAGGNTNCCCCAGNG 

NCNGANTGTGGGGTCNNGCCNTTCNT 

GNTCCACAANCCAACTTGGCAGACGC 

TTACTGTNCTGTCAACTNTCNNhfNGAA 

TACCNCCACCCNCATGCTAAAATGATG 

ACTGACGTTAANCCATGCTGGT 


HSC-DD-084 


CGATGACAAAGGAGTCCTGAGGCAGA 

TTACTCTGAATGACCTTCCTGTCGGAA 

GATCAGTGGACGAGACACTGCGTTTG 

GTTCAAGCCTTCCAGTACACTGACAAG 

CATGGAGAAGTCTGCCCTGCTGGCTGG 

AAACCTGGTAGTGAAACAATAATCCC 

AGATCCAGCTGGAAAACTGAAGTATTT 

CGACAAGCTAAACTGAAAAGTACTTC 

AGTTATGATGTTTGGACCTTCTCAATA 

AAGGTCATTGTG 



wo 99/10535 



PCT/US98/17283 



-39- 



HSC-DD-128 


CGATGCTGAATAAGCTCCTCAAAAAGT 

GGTAAATTTAACCTTTTNAAAAAACAA 

GCTTTCTCTGTACAGCTCTGGCTGTTTT 

GTTCTGGAATACATTCTGTAGAATTGT 

CTGGCCTCTAACTTGGAGATCCAACTC 

CCTCTGCCTCTTGAGTGCTGGGATTAA 

TGGCATGTGACACTGT 


HSC-DD-140 


CGATGACCTCATGCCGGCCCAGAAGT 

GAAGCCTGGCCCTCGCCACCATCAGG 

CTGCCGCTTCCTAACTTATTAACCGGG 

CAGTGCCCGCCATGCATCCTTGANGTT 

TGCCGCCTGGCGGCTGAGCCCTTAGCC 

TCGCTGTAGAGACTTCTGTCGCCCTGG 

GTAGAGTTTATTTTTTTGATGGNTAAN 

CTGTTGCTGACACTGAAAATAANGTAG 

GGTTT 


HSC-DD-148 


CGATCAATGAAAAGATGACGAGTTTCT 

TTCAAATGGGCAGTTACTCCCTGATAA 

CTTCATAGCTGGCTGCACAGAGAAGA 

AAATCCCTGTTGTGTTTAGACTACAAG 

AGGGTTATGATCATAGCTACTACTTCA 

TTGCAACTTTCATCGCTGACCACATCA 

GACACCATGCTAAGTACCTGAATGCAT 

GANAAGCCTCAGCCAAGAGAATCTCA 

TCAGGAGGCCGGAAGGGAATCAACAG 

GAGTGCTGACTTCCTCGCAGAAGATCA 

TGCTCCTGCAGCTGAATCGCTTTTCTG 

AATAAATAT 



wo 99/10535 



PCT/US98/17283 



-40- 



HSC-DD-176 


CGATGTNTACTTCATTGCCACCCTGTC 

ANTCCTCTGGAAGGTGTCCGTCATCAC 

CTTGGTCAGCTGTCTCCCCCTCTATGT 

CCTCAAGTACCTGCGGAGACGGTTCTC 

CCCACCCAGCTACTCGAAGCTCACTTC 

CTAAGCTGCAGGGCTGCCTCGGGCAG 

GGCCTCCGGCCTCCGGCGCTCTCCCAG 

GAGGAGGTCAAGTTCCACACGCACGA 

GCCGCCTCTGCTGGACGGTGCAGTCAT 

GGCTGGCACATGAGGCTTCGCTGAGG 

CGACACTGGGCACCTAATGGGGATGG 

AACATTGGTGGAACCGGAGGGAGGGA 

CCTGAGAGCTGTACCTATCAGAACCTT 

GGGTGCTAAGCTGTGCTGAGGGGGAA 

GACGTGGGACCGGATGGCCCGTCTGA 

GGTTTGTGGGGTCACTGTGCAAGCTTC 

CTTATGGTTTGAACCTCTTGTCATGTG 

ATAAAAGT 


HSC-DD-178 


CGATTTACGTATTTGACTGAAATGAAA 

GTTCCACTAAACGGTATTTGCTCTTGT 

GATATGTGGCACATTGTGATATTTTCT 

TAGTCTGTTCTGTTTCATTTAAAAAAT 

AAAACTGCTGAT 


HSC-DD-180 


CCGATGTNCGATAATAGTAAATACCTT 

AATTANTTAAATAATTCATTGNATTGT 

TTCAGAGACGTTTGGAAATTACTGTAT 

ACATTTACAACCTAATGACTTTTGTAT 

TTTATTTTTCAAAANAAAAGCTTA 



wo 99/10535 



PCTAJS98/17283 



-41- 



HSC-DD-186 



CNTTNGNNNNTCCNTNCATCNCNGCN 

GTNTGAGTCCCNCCCAANNAGTCCATC 

CAANANCCANNGCATNNCAGCTTTAT 

CATGACAACAAANTGGAGNAAGAAGA 

AGATGAGTTTCGGCCACTGTTGAGGCA 

AATCNNTGNNNANTCNTAATANACAC 

CTGGTCCGCTCATCCTTCAACGTTGTT 

NTNTANAANTTACCTCCCAGTAGAAA 

NGCTAGCAANTTTNACCTGCCACNGGT 

TNTA 



HSC-DD-191 



CGATCAGATGTCACGCGGGACACANC 

NCCGCCNCAGTNAATGGNAATATATTT 

GCATGTTACCCCAAATTANCTTCTNTG 

CATNGAACATANGTANGTGTCTTTGGG 

GACACGTGTGTTCTACTAC 



wo 99/10535 



PCT/US98/17283 



-42. 



HSC-DD-158 


CGATTTACAAATGAACAANCAAGATT 

ACATATANTGAAAATCCACGCAGGAC 

CTATTACANAGCATGGTGAAATAGATT 

ATGAAGCAATTGTAAAGCTTTCAGATG 

GCTTTAATGGAGCATGACCTGACAAAT 

GTTTGTACTGAAGCAGGTATGTTTGCA 

ATTCGTGCCGATCATGATTTTGTANTT 

CAGGAAGACTTCATGAAAGCAGTCAN 

GAANGTGGCTGACTCCAAGAAGCTGG 

AGTCCAAGCTGGACTACAAACCTGTGT 

GATTCACTANNAGGGTTTGGTGGCTGC 

ATGACAGACATTGGTTTAATGTANACT 

TAACNGTTANNGAAACTAATGTANNT 

ATTGGCAATGANCTTATTANAAGTGAA 

TANACATGTG 


HSC-DD-099 


CGATGTTTTTAATTAAGAAGAAATTCA 

CTTTCTCATTACCTATGAATCTGTGCC 

AGGGCAGGTGATTTTTGAGTATGAGA 

ACTTTGTCCTCTCCACAGTTGTCACAA 

AAATGGTTCCTTCTCATTGAACTATTG 

TGGCATGCTAATTAAGAAGTGAGTGA 

CCACTTGGGAGGCAGAGGCAGGTGGA 

TTTCTGAGTTTGAGGCCAGCCTGGTCT 

ACAAAGTGAGTTCTAAGACAGCCAGG 

GCTATACAGAGAAACC 



wo 99/10535 PCT/US98/17283 



-43- 



HSC-DD-222 


CCAAGNAATATGGTCTAATCAAAGGT 

CGTCTGTCTGCTTTTGATTGTCTACATC 

ACAGCAATCCCTGGGAATTTCTATCCA 

TTTTAAATGCNGCCGCTTTCATCTGTTT 

AGCCAGCACACCCAATGGTTTCACTAA 

CTAGCCCAGTTGACCTTTTGGAAGTTT 

GAGCCTTGAGCACCTTCAACAAAATTG 

AGCACTCTGATTAGGATATCCACTTTG 

CAAATAAAACCAAATGTTTTGTCAAC 


HSC-DD-104 


CGATGAGGGGAAGATGACCTGGGCCG 

GGGAGGCCATCCCTTATCCAAGATCAC 

AGGGAATTCTGGGAAGAGGTTGGCCT 

GTGGCATCATTGCACGCTCTGCCGGCC 

TTTTCCAGAACCCCAAGCAGATCTGCT 

CCTGTGATGGCCTCACTATCTGGGAGG 

AGCGAGGCCGGCCCATTGCCGGTCAA 

GGCCGAAAGGACTCAGCCCAACCCCC 

AGCTCACCTCTAAACAGAGCCTCATGT 

CAGGTTATTTGGTCCTCGTAGCTGAAC 

ATCTTCTTGCAGAGGGAGCTGCNGGCC 

CTTGCTTGTACAGGCCTAAGTACAGGG 

CAGATAAGTGCTGTAGCCTGAACAAA 

TTAAATTGTTAC 



wo 99/10535 



PCT/US98/17283 



-44- 



HSC-DD-172 


CGATTAGCTGNGGTCTCTAGGANATAC 

TCGTCACTATATGAGCTCAGGANGCCA 

GCTCTTAGTAGCTCTGAANCAGGTGAA 

GAATCCTCCTCTGAGGAAACAGACTG 

GGAGGAAGAAGCAGCCCATTACCAGC 

CAGCTAATTGGTCAAGAAAAAAGCCA 

AAAGCNGCTGGCGAAAGTCAGCGTAC 

TGTTCAACCTCCCGGCAGTCGGTTTCA 

AGGTCCGCCCTATGCGGAGCCCCCGCC 

CTGCGTAGTGCGTCAGCAATGCGCAG 

AGGGGCAATGCGCAGAGAGGTGCGCA 

GAGGGGCAGTGCGCAGAGAGGTGCGC 

AGAGAGGCAGTGCGCAGAGAGGCAGT 

GCGCAGACTCAT 


HSC-DD-169 

r ■ 


CGATTTCTAAATCAGTCTCGCCTGTGC 

TAGGATGACCGGTAATGAGCCTGTTTA 

AAATAAGACTTAAAAGTGTCGTGCGTT 

GGCCGGGCGGTAGGGGCGCATGCCTT 

TAATTTCATAACTTGGAGGTAGAGACA 

GGCGGATCTTTGTGAGTTCAAGGTCAG 

CCTGGTGTACAGAGTGACTTCCAGAAC 

AGCCAGGGCTGTTAAACAGAGAAAC 


HSC-DD-003A 


TTGTTTTGTTNTTCAGATAGGGTCTTAC 
ATATCCCATGCTGGTCTCAAAGTCACA 
TTATGCATGCGGGGAAAGCCATTTACT 
GACTGATATACCCCTGGCCCTAAGATA 
GATC 



wo 99/10535 



PCT/US98/17283 



-45- 



HSC-DD-092 


CGATCGTCGTTCTGGTAAGAAGCTGGA 
AGATGGCCCCAAGTTCCTGAAGTCTGG 
CCATTTAAGTTTAATAGTAAAAGACTG 
GTTAATGATAACAATGCATCGTAAAAC 


HSC-DD-114 


CGATCGTCGTTCTGAGTAANAAGCTGG 

AANANGGCCCCAAGTTCCTGNNGTCT 

GGCGATGCTGCCATTTAAGTTNANNAG 

ANANAAGACTGGCTNATGATAACAAT 

GCANCNTAAAACCTTCAGGNAGGNAA 

CGAATGTTGTGGACCATTTTTTNTGNG 

TGTGGCAGTTTNAAGTTATNAAGNTTT 

CAAAANCANTACTTNTTAANGGGAAC 

AACTTGACCCATCANCTGTCACAGAAT 

NTTGANGACCATTAACAC 


HSC-DD-213A1 


NCTACGATCATCTAGATCTACTAGACC 

TACNACNAGACCATGGGCCAAANATG 

GTCGACCTGCAAACTTGCAAGGTTTAT 

TTTANATACACATTATGGCGTTTTATN 

TTTTGTAATTCTAAGTTGTAATTCAGCT 

TTTAACAAATCTTTTT 


HSC-PD-213A1' 


CCAAGNANATCNAGACTACTAGACCT 

ACTACNAGACCATNGGNCAAACATGG 

TCGACCNNCAAACGNATANGTATATTT 

NANATACACANANATAGCGTTNTATG 

TCTNGTAATTCTAAGTNGTANATCANC 

TATTANCAAAATCTTTNTTT 



wo 99/10535 



PCT/US98/17283 



-46- 



HSC-DD-155 


CGATGGAAGTTCTGCTGAGCCCTTCTG 

ACGTAACCCTGGCNATGGCTAACACTG 

TCCTTCCTGCAATGTTCNTGGTGGACA 

CANCTTCTCTGGANATACCCTGAANGT 

GGCACGCCCTGTTCCAGCCCACCTGGT 

GTGCACTTTTTGCCCTCTTTACCTCATT 

ANTAAATGTTTTCNTGCTCCTAATG 


HSC-DD-212 


CTNAGNAAGGANCTGTACTTCGTATTG 

CAAGGCAGTCTCTTGTGTCTTCTTAGA 

GTGTCTTCCCCATGGACAGCCTCAGTT 

TGGAGCACTAGTTTATAATGTTTATTA 

CAATTTTTAATAAATTGANTAGGTAGT 

A 


HSC-DD-090 


TCNTCNTTCTGGTAAGAACTGGAATAT 

GGCCCCAAGTTCCTGAAGTCTGGCGAT 

GCTGCCATTGTTGATATGGTCCCTGGC 

AANCCCATGTGTGTTGAGAGCTTCTCT 

GACTACCCTCCACTTGGTCGCTTTGCT 

GTTCGTGACATGAGGCAGACAGTTGCT 

GTGGGTGTCATCAAAGCTGTGGACAA 

AAANGCTGCTGGAGCTGGCNAAGTCA 

CCAAGTCTGCCCANAAAGCTCAGAAG 

GCTAAATGAATATTACCCCTAACANCT 

GCCACCNCANTCTTAATCAGTGGTGGA 

AGAACGGTCTCAGAACTGTTNGTCTCA 

ANTGGCCATTTAAGTTTAATANTAAAA 

GACTGGTTAATGATAAC 




wo 99/10535 PCT/US98/17283 



-47- 



HSC-DD-173 


CGATCNTCGTTCTGGTAAGANNCNGG 

AACATGGCCCCAAGTTCCNGANNTCTG 

GCGANGCNGCCANTGTTGATATGGTCC 

CTGGCAAGCCCATGTGTNTTGAGAGCT 

TCACNNACNACCCTCCANTtGGTCGCT 

TTGCTGTTCGTGACATGAGGCAGACAG 

TTGCTGTGGGTGTCANCAAANCTGTGG 

ACAANANGGCTGCTGGAGCTGGCAAG 

NTCACCAANTCTGCCCAGAAAGCTCA 

GAATGCTAAATNAATATTACCCCTAAN 

ACCTGCCACCCCAGTCNTAATCAGTGG 

TGGAATAACNGTCTCAGAACTGTTTGT 

CNCAATTGGCCANTTANGTTTAATNAT 

ACAAGACTG 


HSC-DD-249 


GNNNNNNNNNNNCNANGAAAAAGAG 

GTGAAAAATGCTTGGCTCTAGCTGATG 

ACAGAAAGCTGAAATCCATCGCCTTCC 

CATCCATTGGCAGCGGCAGGAACGGG 

TTCCCGGAAGCAGACAGCGGCCCAGC 

TCATTCTGAAGTGCCATCTCCAGCTAC 

NTTGTCTCCACGATGTCCTCCTCCATC 

AAAACTGTGTACTTCATGCTTTTTGAC 

AGTGAGAGCATAGGTATCTATGTGCA 

GGAAATGGCCAAGCTGGACGCCAACT 

AGGCCAGTGATCCCTAGAGCCAGCAC 

ATGCGGTGTCCCCCA 



wo 99/10535 



PCT/US98/17283 



-48- 



HSC-DD-250 


CTNANGAAAGCTGCTGGGGCNCCCTG 

ACATCACTCATCACTCACTATGCTACC 

AATTCTATTTATTTCGGAATTACAAGA 

TATCGGGAATCTCTCTGCAGGCTGGAC 

TGGCAGGCTGTGGGGTGGGCGGGACA 

CGGCTCTTAACA'l riNCAGAGGGAAAC 

GCGCANATGTCCAAAAGTCTAAATAA 

ATGCATTCAGAGGTTTNTGGGGTCCAT 

GGCCAAGTGGAGTTCCCCCNCAGGGG 

GAGGTGGGGTAAGTGCCTCCAGGAAG 

GCAGGCAGCCTGCCTTANACTTGCANC 

CCGGNTGTGGGAATGAATCATTGGAG 

TAATAAACT 


HSC-DD-108 


CGATGCCAATGGCATCCTCAATGTTTC 

TGCTGTAGATAAGAGCACAGGAAAGG 

AGAAAGTCTGCAACCCTATCATTACCA 

AGCTGTACCAGAGTGCAGGTGGCATG 

CCTGGGGGAATGCCTGGTGGCTTCCCA 

GGTGGAGGAGCTCCCCCATCTGGTGGT 

GCTTCTTCAGGCCCCACCATTGAAGAG 

GTGGATTAAGTCAGTCCAAGAAGAAG 

GTGTAGCTTTGTTCCACAGGGACCCAA 

AACAAGTAACATGGAATAATAAAACT 

ATTTA 



wo 99/10535 



PCTAJS98/17283 



-49- 



HSC-DD-n6 



CGATGAAGATGAGGTCACTGCAGAGG 

AGCCCAGTGCTGCTGTTCCTGATGAGA 

TCCCCCCTCTGGAAGGCGATGAGGATG 

CCTCGCGCATGGAAGAGGTGGATTAA 

AGCCTCCTGGAAGAAGCCCTGCCCTCT 

GTATAGTATCCCCGTGGCTCCCCCAGC 

AGCCCTGACCCACCTGGATCTCTGCTC 

ATGTCTACAAGAATCTTCTATCCTGTC 

CTGTGCCTTAAGGCAGGAAGATCCCCT 

CCCACAGAATAGCAGGGTTGGGTGTT 

ATGTATTGTGGTTTTTTTGTTTGTTTTA 

TTTTGTTCTAAAATT 



wo 99/10535 


PCT/US98/17283 


-50- 










TOPTOTAr^AT A ArJ AHP AP ArrrJA A Af^n 




APJA APA AHATP APP ATPAPP A ATHAP 




A AnnptPPrjpT^riAriTA a no a a oat at 




TO A nPOP A TnOTPP A A O A A OPTO A n A 




AOTAPA AOOPTOAOOATOAOAAOPAO 




AGAGATA AGGTTTPPTPP A AG A APTP A 




PTGG A GTPPT A TOPPTTP A A P A TO AAA 




OPA APTOTOO A AOATOAOA A APTTPA 




A OOP A AO ATP A ATOATOAP^OAPA A AP 




A O A A O A TTPTTO A P A A OTOO A A TO A A 




A TO A TO A riOTOOOTOO ATA A O A A OO A 




O A OTOO A O A 1^ A A On A A A A THnPO A r^O 




A TP A OO AOAAAOAA OTOO A O A A A OTP 
A X AUrC- AOAAAljAAL^ X OvjAVjAAAvJ X 




TOPA APPPTATPATTAPPA AOPTOTAP 
X AAVxV^ V-/ X A 1 L>A X X AV^v-/AAvJv-/ X VJ X 


'- 


P A O A OTOP t^C^CWC^C^C A TOPPTOOOOO 




A A TOPPTOOTOOPTTPPP A C^CWC^C^ A OO 
AA X VJV^v^ X VJvJ X OOv-/ X 1 V^v^^ AVJvJ X VJVJAVJVJ 




A dOTCOCCO A TPTOOTOOTOPTTPTTP 




AGGPPPCACPATTGAANAGGTGGNTT 




AAGTNATCCANNAAGAAAGGNTNCCT 




TTTTTTCCAAAGGGANCCAAAAAAGTA 




ANATGGATAATAAAACCTATTTAATt 



wo 99/10535 



PCTAJS98/17283 



-51- 



HSC-DD-184 



CGATGCCAATAGNANCCCAANTNTCT 

GCNGTNGATAAGACACANGAAAAGAG 

AACAAGATCACCATCACCAATGACAA 

GGGCCGCTTGAGTAAGGAAGATATTG 

AGCGCATGGTCCAAGATCAATGATGA 

GGACAAACAGAAGATTCTTGACAAGT 

GCAATGAAATCATCAGCTGGCTGGAT 

AAGA 



HSC-DD-101 



CGATTAGCGGAGGTCTCTAGGAGATA 
CTCGTCACTAGATGAGCTCAGGAAGCC 
AGCTCTTAGTAGCTCTGAAGCAAGTGA 
AGAATCCTCCTCTGAGGAAACAGACT 
GGGAGGAAGAAGCAGCCCATTACCAG 
CCAGCTAATTGGTCAAGAAAAAAGCC 
AAAAGCGGCTGGCGAAAGTCAGCGTA 
CTGTTCAACCTCCCGGCAGTCGGTTTC 
AAGGTCCGCCCTATGCGGAGCCCCCG 
CCCTGCGTAGTGCGTCAGCAATGCGCA 
GAGGGGCAATGCGCAGAGAGGCAGTG 
CGCAGAGAGGCAGTGCGCAGACTCAT 

TCATT 



HSC-DD-017 



TCTCTGTATAACCCTGGATGTCCTGGA 
ACTCACTTTGTAGACCAGGTTGGCCTC 
GAACTCAGAAATCCGCCTGCCTCTGCC 
AAGCGCTGGGATTAAAGGTGTGCGCC 
ACCACACCCGGCAGGTAATTTTTTTCT 
TTTTAAAGATTTATTATGTATACAGGT 
TCTGCCTACATGTGTACCTGCCGGCCA 
GAAGAGGGCATCANATC 



wo 99/10535 



PCT/US98/17283 



-52- 



HSC-DD-026 


GATCTTTGTAGGCACAAAATGAATCCC 

GCACCTGGTGACCCATGATGCTCGTAC 

TATTCGGTACCCTGATCCCCTCATCAA 

GGTGAACGACACCATTCAGATTGATTT 

GGAGACAGGCAAAATAACTGACTTCA 

TCAAGTTTGACACTGGGAACCTGTGTA 

TGGTGACTGGAGGTGCTAACTTGGGA 

AGAATTGGTGTAATCACCAACAGAGA 

GAGACATCCCGGCTCTTTTGATGTGGT 

TCATGTGAAAGATGCCAATGGCAACA 

GCTTTGCCACTCGGCTGTCCAACATTT 

TTGTTATTGGCAAGGGTAACAAACCAT 

GGATCTCTCTTCCCAGAGGAAAAGGA 

ATCCGCCTCACCATTGCTGAAGAGAGA 

GACAAGAGGCTTGCGGCCAAACAGAG 

CAGTGGGTTGAAATGGTCTCCTAGGAG 

ACATGCCTGGAAAGTTGTTTTGTACAA 

CCTTTCTCAGGCAACATACATTGCTAG 

AATTAAACAGCCATG 


HSC-DD-064 


CGATCGAGAGGGCAAACCACGGAAGG 

TGGTTGGTTGCAGTTGCGTAGTGGTTA 

AGGACTATGGCAAAGAATCTCAGGCC 

AAGGATGTCATCGAGGAAATACTTCA 

AGTGCAAGAAATAAATAAATTTTGGCT 

GATT 



wo 99/10535 



PCTAJS98/17283 



-53- 



HSC-DD-066 


ATTCCAGATGAGGACGACAAGCGACT 
CATTGATTTACATAGTCCTTCTGAGAT 
TGTTAAGCAGATTACTTCCATCAGTAT 
TGAGCCGGGAGTTGAGGTTGAAGTCA 
CCATTGCAGATGCCTAAGACAACTGA 
ATAAATCG 


HSC-DD-041 


GATCTATACAGTCGGGAAACGCTTCAA 

GGAAGCAAATAACTTCCTGTGGCCCTT 

CAAGTTATCTTCCCCACGAGGTGGGAT 

GAAGAAAAAGACAACTCACTTTGTAG 

AAGGTGGAGATGCTGGCAACAGGGAA 

GACCAGATAAACAGGCTTATTAGACG 

GATGAACTAAGGTGTCACCCATTGTAT 

TTTTGTAATCTGGTCAGTTAATAAACA 

GTC 


HSC-DD-111 


CGATGTGGCCAAAGTCAATACCCTGAT 

AAGGCCCGACGGAGAGAAGAAGGCGT 

ATGTTCGCTTGGCTCCTGATTATGATG 

CCCTAGATGTTGCCAACAAGATTGGGA 

TCATCTAAACTGAGTCCAGATGGGTAA 

TTCTAAATATATACTTT 


HSC-DD-028B 


GATCTGGAACCAtAGATGCGAGCATC 
AGCAACAGAATACAAGAAATGGAAGN 
GNGAATCTCAGGTGCAGAAGNTTCCA 
TAGAGAACATCG 



wo 99/10535 



PCT/US98/17283 



-54- 



HSC-DD-142 


GCGATGCAAAATCCTTAATANAATTCT 

TGCTAACCGAATCCAAGAACACATTA 

AAGCAATCATCCATCCTGACCAAGTAG 

G rn TATTCCAGGGATGCNGNGATGGT 

TTAATATATGAAAATCCATCAATGTAA 

TCCATTNTATAAACAANCTCAANGACA 

NAAACCACATGATCATCTCGTTAGNTG 

CAGAAAAAGCATTTGACAAGATCCAA 

CACACATTCGTGATAANAGTTTTGGNA 

AGATCAGGAATTCAAG 


HSC-DD-095 


CGATNNACCCGCTCTACCTCACCATCT 

CTTGCTAATTCAGCCTATATACCGCCA 

TCTTCAGCAAACCCTAAATNAGGTATT 

AAAGTAAGCATCNAGAATCANCCATA 

CTCAACGTNACGTCAAGGTGTACCCAA 

TGNAATGGGAAGAAATGGGCTACATT 

TTCTTATANAAGAACATTNCTATACCC 

rilNTGAAACTAA 



Table 3 presents the expression patterns of the differentially expressed bands set 
5 forth in Table 2. The band fragment length (size) in Table 3 is the length before 
unwanted terminal sequences were removed. Table 3 also presents the results of a 
GenBank Search and analysis of the sequences of Table 2. 



wo 99/10535 



PCT/US98/17283 



w 



-55- 



S 
S 

1 

C 
O 

o 



3 

^? 

CO 

1 

S 
O 



E 

I 

(A 

£ 



o 

VI 

c 

I 

c 
-6 
c 

CD 



c 

c 
c 



i5 



c 
5 

c 



4 

I 



E 

C 



c 
e 



E 

E 
s 



CM 



cn 



CN4 



CO 



CO 



CM 



I ^1 



I 



I 



I 



I 



I 



C 6 



2 S 

CM 



O 



CM 



O 
Q 

O 
CO 

I 



s 



fM 

o 



o 



^ 1 

3 I 

i! 

5; 



awcnorin' <WO 991053&A1 I > 



wo 99/10535 



PCTAJS98/17283 



-56- 



< 



e 



2 

C 

o 

75 
o 
o 

M 
V) 
<P 

c 

CO 
w 

I 

£ 



CD 

E 
cr 



CD 

0) 

V) 



Ui 



<>4 



o 



E 
o 

CO 



0) 

iS 
E 

K 

o 
a. 

3 
(A 



c 

'55 
o 

Q. 
Q. 

s 

0 



4? 

c 



a. 
< 

o 



o 

t 



C 
E 



CM 



CM 



CM 



CM 



CM 



-4- 
CO 



CM 



CM 



CO 



en 



2 ^ 



E 



35 e 



E 



I 



S5 

a 



CO 

o 

CM 



o 

6 
o 

6 

X 



< 



o 



CM 
CM 



6 
o 

6 

CO 
X 



I 



II 



•£2 



I 



CO 



CO 



6 
o 

6 

CO 

r 



o 



m 
O 



I. 



o 
o 



2 

X 



i5 

u 



o 
a 



o 
o 

a 

CO 
X 



CM 



o 

6 
o 

6 

CO 
X 



CM 

§ 
z 



O 



a 
o 

6 

CO 

X 



a 
u 



CM 
fsi 



6 
o 

6 

CO 



< 



< 

fO 

o 
o 

6 

Q 

6 

CO 
X 



wo 99/10535 PCT/US98/17283 



-57- 



e 

< 

ft 
« 



CO 



UJ 



9 
</) 

c: 

U 

.£ 

0) 

o 



V) 

5. 

2 



s 

I 

UJ 



o 

CM 

o 



I 

< 

i 



i 

t: 

s 



c 
E 



e 

e 
c 

c 



E 
E 

3 



C>4 



CM 



CM 



i 



CO 



Csl 



Csl 



I 



1 



i! 



E 

H 
C 



JI3 



CM 



8 



CM 



CO 



CO 



X X 



8 



Q 

ii 



wo 99/10535 



PCT/US98/ 17283 



-58- 

As is apparent to one of ordinary skill in the art, this same procedure can be used 
to identify stem cells genes whose expression levels are associated with stem cell 
proliferation, dedicated differentiation and survival. 

5 Example 2 

Method to identify a therapeutic agent that modulates the expression of at least one stem 
cell gene associated with the differentiation process of a stem cell population. 

The methods set forth in Example 1 offer a powerful approach for identifying 
therapeutic agents that modulate the expression of at least one stem cell gene associated 

10 with the differentiation process of a stem cell population. For instance, gene expression 
profiles of undifferentiated stem cells and partially differentiated or terminally 
differentiated stem cells are prepared as set forth in Example 1. A profile is also prepared 
from an imdifferentiated stem cell sample that has been exposed to the agent to be tested. 
By examining for differences in the intensity of individual bands between the three 

15 profiles, agents which up or down regulate genes associated with the differentiation 
process of a stem cell population are identified. 

Examples 

Method to identify a therapeutic agent that modulates the expression of at least one stem 
20 cell gene associated with the proliferation of a stem cell population. 

The methods set forth in Example 1 offer a powerful approach for identifying 
therapeutic agents that modulate the expression of at least one stem cell gene associated 
with the proliferation of a stem cell population. For instance, gene expression profiles of 
undifferentiated stem cells and actively proliferating stem cells are prepared as set forth 
25 in Example 1 , A profile is also prepared from an undifferentiated stem cell sample that 
has been exposed to the agent to be tested. By examining for differences in the intensity 
of individual bands between the three profiles, agents which up or down regulate genes 
associated with the proliferation of a stem cell population are identified. 



wo 99/10535 



PCT/US98/17283 



-59- 

As is apparent to one of ordinary skill in the art, this same procedure can be used 
to identify stem cells genes whose expression levels are associated with stem cell 
dedicated differentiation and survival. 

Example 4 

5 Production of solid support compositions comprising groupings of nucleic acids or 
nucleic acid fragments that correspond to genes whose expression levels are associated 
with the differentiation, proliferation, dedicated differentiation or survival of stem cells. 

As set forth in Example 1, expression profiles prepared firom stem cells at 
different stages of differentiation, from proliferating stem cells, from stem cells that are 

10 dedicated to a differentiation pathway and firom stem cells resistant to apoptosis (which 
may be linked to increased survival) provide a means to identify genes whose expression 
levels are associated with stem cell differentiation, proliferation, dedicated differentiation 

and survival, respectively. 

Solid supports can be prepared that comprise immobilized representative 

15 groupings of nucleic acids or nucleic acid fragments corresponding to the genes fix>m 
stem cells whose expression levels are modulated during stem cell differentiation, 

proliferation, dedicated differentiation and survival. For instance, representative nuclieic 
acids can be immobilized to any solid support to which nucleic acids can be immobilized, 
such as positively charged nitrocellulose or nylon membranes (see Sambrook et al. 
20 (1989) Molecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring Harbor 

Laboratory) as well as porous glass wafers such as those disclosed by Beattie (WO 
95/1 1755). Nucleic acids are immobilized to the solid support by well established 
techniques, including charge interactions as well as attachment of derivatized nucleic 
acids to silicon dioxide surfaces such as glass which bears a terminal epoxide moiety. At 
25 least one species of nucleic acid molecule, or Augment of a nucleic acid molecule 

corresponding to the genes from stem cells whose expression levels are modulated during 
stem cell differentiation, proliferation, dedicated differentiation and survival may be 
immobilized to the solid support. A solid support comprising a representative grouping 
of nucleic acids can then be used in standard hybridization assays to detect the presence 



wo 99/10535 



PCTAJS98/17283 



-60- 

or quantity of one or more specific nucleic acid species in a sample (such as a total 
cellular mRNA sample or cDNA prepared from said mRNA) which hybridize to the 
nucleic acids attached to the solid support. Any hybridization methods, reactions, 
conditions and/or detection means can be used , such as those disclosed by Sambrook et 
5 al (1989) Molecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring Harbor 
Laboratory, Ausbel et al (1987) Current Protocols in Molecular Biology , Greene 
Publishing and Wiley-Interscience. N.Y. or Beattie in WO 95/1 1755. 

One of ordinary skill in the art may determine the optimal number of genes that 
must be represented by nucleic acid fragments immobilized on the solid support to 

10 effectively differentiate between samples that are at the various stages of stem cell 
differentiation, including terminal differentiation, proliferating stem cells, stem cells 
dedicated to a given differentiation pathway and/or stem cells with increased survival 
rates. Preferably, at least about 5, 10, 20, 50, 100 , 150, 200, 300, 500, 1000 or more 
preferably, substantially all of the detectable mRNA species in a cell sample or 

15 population will be present in the gene expression profile or array affixed to a solid 

support. More preferably, such profiles or arrays will contain a sufficient representative 
nimiber of mRNA species whose expression levels are modulated under the relevant 
differentiation process, disease, screening, treatment or other experimental conditions. In 
most instances, a sufficient representative number of such mRNA species will be about 1, 

20 2, 5, 10, 15, 20, 25, 30, 40, 50, 50-75 or 100 in number and will be represented by the 
nucleic acid molecules or fragments of nucleic acid molecules immobilized on the solid 
support. For example, nucleic acids encoding all or a fi-agment of one or more of the 
known genes or previously reported ESTs that are identified in Tables 2 and 3 may be so 
immobilized. Additionally, the skilled artisan may select nucleic acids encoding the 

25 protein cell surface markers discussed above at page 8 (i.e., CD 34) in order to help 
identify the particular stage of differentiation of a given stem cell population and to 
identify agents that are involved in promoting such differentiation. The skilled artisan 
will be able to optimize the number and particular nucleic acids for a given purpose, i.e., 
screening for modulating agents, identifying activated stem cells, etc. 



wo 99/10535 



PCTAJS98/17283 



-61- 

In general, nucleic acid fragments comprising at least one of the sequences or part 
of one of the sequences of Table 2 can be used as probes to screen nucleic acid samples 
from cell populations in hybridization assays. Altematively, nucleic acid fragments 
derived from the identified genes in Table 3 which correspond to the sequences of Table 
5 2 may be employed as probes. To ensure specificity of a hybridization assay using probe 
derived from the sequences presented in Table 2 or the genes of Table 3, it is preferable 
to design probes which hybridize only with target nucleic acid under conditions of high 
stringency. Only highly complementary nucleic acid hybrids form xmder conditions of 
high stringency. Accordingly, the stringency of the assay conditions determines the 
10 amount of complementarity which should exist between two nucleic acid strands in order 
to form a hybrid.,Stringency should be chosen to maximize the difference in stability 
between the probe:target hybrid and potential probe:non-target hybrids. 

Probes may be designed from the sequences of Table 2 or the genes of Table 3 
through methods known in the art. For instance, the G+C content of the probe and the 
1 5 probe length can affect probe binding to its target sequence. Methods to optimize probe 
specificity are commonly available in Sambrook et al. {Molecular Cloning: A Laboratory 
Approach. Cold Spring Harbor Press. NY, 1989) or Ausubel et al. (Current Protocols in 
Molecular Biology. Greene Publishing Co., NY, 1995). Any available format may be 
used in designing hybridization assays, including immobilizing Uie probes to a solid 
20 support or immobilizing the cellular test sample nucleic acids to a solid support. 

It should be understood that the foregoing discussion and examples merely 
present a detailed description of certain preferred embodiments. It therefore should be 
apparent to those of ordinary skill in the art that various modifications and equivalents 
can be made Avithout departing from the spirit and scope of the invention. All documents, 
25 patents and references, including provisional patent application 60/056,861 , referred to 
throughout this application are herein incorporated by reference. 



wo 99/10535 



PCT/US98/17283 



-62- 

- What is Claimed Is: 

1 . A method to identify an agent that modulates the expression of at least one 
stem cell gene associated with the differentiation process of a stem cell population, 
comprising the steps of: 
5 preparing a first gene expression profile of an undifferentiated stem cell 

population; 

preparing a second gene expression profile of a stem cell population at a 
defined stage of differentiation; 

treating said undifferentiated stem cell population with the agent; 
10 preparing a third gene expression profile of the treated undifferentiated 

stem cell population; 

comparing the first, second and third gene expression profiles; and 

identifying an agent that modulates the expression of a least one gene in 
xmdifferentiated stem cells that is associated with stem cell differentiation. 

15 2. A method to identify an agent that modulates the expression of at least one 

stem cell gene associated with the proliferation of a stem cell population, comprising the 
steps of: 

preparing a first gene expression profile of a non-proliferating stem cell 

population; 

20 preparing a second gene expression profile of a proliferating stem cell 

population; 

treating the non-proliferating stem cell population with the agent; 
preparing a third gene expression profile of the treated stem cell 

population; 

25 comparing the first, second and third gene expression profiles; and 

identifying an agent that modulates the expression of a least one gene that 
is associated with stem cell proliferation. 



wo 99/10535 PCI7US98/17283 



-63- 

3 . A composition comprising a grouping of nucleic acid molecules that 
correspond to at least part of the sequences of Table 2 or genes of Table 3 affixed to a 
solid support. 




FIG. 1 (Cont.) 



m 



INTERNATIONAL SEARCH REPORT 


International application No. 
PCT/US98/17283 


A, CLASSIFICATION OF SUBJECT MATTER 

IPC(6) :C12Q 1/68; C12N 15/12 

US CL : 435/6; 536/23.5 
Accorxiing to International Patent Classification (IPC} or to both national classification and IPC 


a FIELDS SEARCHED 


Minimum documentation searched (classification system followed by classification symbols) 
U.S. : 435/6; 536/23.5 


Documentation searched other than minimum documentation to the extent that such documents are included 


in the fields searched 


Electronic data base consulted during the international search (name of data base and, where practicable, search terms used) 
APS. Medline, WPIDS 

search terms: hematopoietic stem cell, differential display 


C. DOCUMENTS CONSIDERED TO BE RELEVANT 


Category* 


Citation of document, with indication, where appropriate, of the relevant passages 


Relevant to claim No. 


X 


TAGOH et al. Molecular Cloning and Characterization of a Novel 
Stromal Cell-Derived cDNA Encoding a Protein That Facilitates 
Gene Activation of Recombination Activating Gene (RAG)-l in 
Human Lymphoid Progenitors. Biochem. Biophys Res. Commun. 
1996» Vol, 221, pages 744-749, especially page 744. 


1. 2 


X 


MOREB el al. Human Al, a Bcl-2-related gene, is induced in 
leukemic cells by cytokines as well as differentiating factors. 
Leukemia. July 1997, Vol. 11, Number 7, pages 998-1004, 
especially page 998. 


1,2 


[ 1 Further documents are listed in the continuation of Box C. | | See patent family annex. 


* Special ctm$one» of eit»d <locuni«iita: 

*A" document 4*fi**^pg the gooeral vtmta of tb* tft which is not c<Muidered 
to ba of pcxttcular roloirKttca 

*E* •«rb«r <loouiD«nt publtshod od or aflttr tb« tntamation«l filing drnta 

*L* doeuncnt which may throw doubti oo priority cUuxi(») or which ti 
citod to «stabl2Bh ih« pubUcstioa data of another citation or other 
■pectal raaaoo (aa specifted) 

'0* document nf«mn$ to an oral diiclosure. use. exhibition or other 

'P* doctfioent published prior lo the tnteraatiooal filing daU but later than 
the priority data claimed 


*T* later doctunent pubHihed after <he tntemational fUtng date or priority 
data and not in conflict whh the application but cited lo understand 
the principle or theory underlying the invention 

"X* document of particular relevance; the claimed invention cannot be 
considered novel or cannot be considered to involve an inventiva ttep 
when the document is taken alone 

'Y* document of particular relevance; the claimed invention cannot be 
considered to involve an inventive step when the document it 
combined with one or more other such documents, such combination 
being obvious to a person skilled in the art 

'A' document in amber of the same patent family 


Date of the actual completion of the international search 
30 NOVEMBER 1998 


Date of mailing of the international search report 


Name and mailing address of the 1SAAJS 
Commissioocr of Pstenu and Trademarks 
Box PCT 

Washington, D.C 20231 
Facsimile No. (703) 305-3230 


Authorized officer r^^\/f(\ A-^^ 

JOHN S. BRUSCA ^^\( '^'^/^ 
Telephone No. (703) 308-0196 V 



Form PCT/ISAy2 10 (second shcetXJuly 1992)* 



INTERNATIONAL SEARCH REPORT 



international application No, 
PCT/US98/17283 



Bos 



I Observ.Hona where certain claims were found unsearchable (Continuarion of Item 1 of Tirst sheet) 



Ixhis intemaliooal itrport has not been established in fcspcct of certain claims under Article 17(2Xa) for the following reasons: 

■ □ 



Claims Nos.: 

because they relate to subject matter not required to be searched by this Authonty, namely: 



HI because they relate to parts of the international application that do not comply with the prescribed requirements to such 
an extent that no mcanmgful international search can be carried out, specifically: 

Mo sequence listing or computer readable form of sequence listing has been supplied, and claim 3 is drawn to specific 
sequences that therefore cannot be searched. 

i ^ ^ te^JL ti^ are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Ob»ervmtions where unity of Invention is lacUng (Continuation of Item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



□ 



all required additional search fees were timely paid by the applicant, this international search report covers all searchable 



As all requ 
claims. 



2. □ As all searehable claims could be searched without effort justifying an additional fee. this Authority did not invite payment 
of any additional fee. 

I 3. As only some of the required additional search fees were timely paid by the applicant, this international search report covers 

' only those claims for which fees were paid, specifically claims Nos.: 



4. rn No required additional search fees were timely paid by the applicant Consequently, this intemaUonal search report is 
' ' testricted to the invention first mentioned in the claims; it is covered by claims Mos.: 



j Remark on Protest 



I I The additional search fees were accompanied by the applicant's protest. 
\ I No protest accompanied the payment of additional search fees. 



Fonn PCrr/ISA/210 (continuation of first sheet(l)XJuly 1992)* 



CORRECTED 
VERSION* 



m 



PCX 



WORLD INTELLECTUAL PROPERTY ORGANIZATION 
International Bureau 




(51) Intemati nal Patent Classification ^ : 
C12Q 1/68, C12N 15A2 


Al 


(11) International Publication Number: WO 99/10535 
(43) International Publication Date: 4 March 1999 (04,03.99) 


(21) IntemaUonal ApplicaUon Number: PCT/US98/ 17283 

(22) InternaUona! FUing Date: 21 August 1998 (21.08.98) 

(30) Priority Data: 

60/056.861 22 August 1997 (22.08.97) US 

(71) Applicant (for all designated States except US): YALE UNI- 
VERSITY [USAJS]; 451 College Street, New Haven, CT 


(81) Designated States: AU. CA, IL, JP. US, European patent (AT. 
BE, CH, CY, DE. DK. ES, H, FR. GB, GR, IE, IT. LU, 
MC. NL, PT. SE). 

Published 

With international search report. 

Before the expiration of the time limit for amending the 
claims and to be republished in the event of the receipt of 
amendments. 



06520 (US). 
(72) Inventors; and 

(75) Inventors/Applicants (for US only): LIU. Meng [CN/US]; 
Apartment 7C, 564 Prospect Street, New Haven, CT 0651 1 
(US). BASKARAN. Namadev [IN/US]; 750 Whitney Av- 
enue, New Haven. CT 06511 (US). WEISSMAN, Sherman, 
M. [US/USl; 459 Saint Ronan Street, New Haven. CT 065 1 1 
(US). 

(74) Agent: ADLER, Rcid, G.; Morgan. Lewis & Bockius LLP, 
1800 M Street, N.W„ Washington. DC 20036 (US). 



(54)Titic: A PROCESS TO STUDY CHANGES IN GENE EXPRESSION IN STEM CELLS 
(57) Abstract . 

The present invention includes a method to identiftr stem cell genes that are differentially expressed in stem cells at various stages of 
differentiation when compared to undifferentiated stem cells by preparing a gene expression profile of a stem cell population and comparing 
the profile to a profile prepared from stem cells at different stages of differentiation, thereby identifying cDNA species, and therefore genes 
which are expressed. The present invention also includes methods to identify a therapeutic agent that modulates die expression of at least 
one stem cell gene associated with the differentiation, proliferation and/or survival of stem cells. 



♦(Referred to in PCT Gazette No. 22/1999, Section II) 

BNSDOCID: <WO 9910535A1_IA> 



m 



FOR THE PURPOSES OF INFORMATION ONLY 
Codes used to identify States party to the PCT on the front pages of pamphlets publishing international applications under the PCX. 



AL 


Albania 


£S 


Spain 


LS 


Lcscrtho 


SI 


Slovenia 


AM 


Arrnema 


FI 


Finland 


LT 


Lithuania 


SK 


Slovakia 


AT 


Austria 


FR 


France 


LU 


Luxembourg 


SN 


Senega! 


AU 


Australia 


OA 


Gabon 


LV 


Latvia 


sz 


Swaziland 


AZ 


Azerbaijan 


GB 


United Kingdom 


MC 


Monaco 


TD 


Chad 


BA 


Bosnia and Herzegovina 


GE 


Georgia 


MD 


Republic of Moldova 


TG 


Togo 


BB 


Barbados 


GH 


Ghana 


MG 


Madagascar 


TJ 


Tajikistan 


BE 


Belgium 


GN 


Guinea 


MK 


The former Yugoslav 


TM 


Turkmenistan 


BF 


Burkina Faso 


GR 


Greece 




Republic of Macedonia 


TR 


Turkey 


BG 


Bulgaria 


HU 


■ Hungary 


ML 


Mali 


TT 


Trinidad and Tobago 


BJ 


Benin ' 


IE 


Ireland 


MN 


Mongolia 


UA 


Ukraine 


BR 


Brazil 


IL 


Israel 


MR 


Mauritania 


UG 


Uganda 


BY 


Belarus 


IS 


Iceland 


MW 


Malawi 


US 


United States of America 


CA 


Canada 


IT 


Italy 


MX 


Mexico 


uz 


Uzbekistan 


CF 


Central African Republic 


JP 


Japan 


NE 


Niger 


VN 


Viet Nam 


CG 


Congo 


K£ 


Kenya 


NL 


Netherlands 


YU 


Yugoslavia 


CH 


Switzerland 


KG 


Kyrgyzsian 


NO 


Norway 


ZW 


Zimbabwe 


a 


C6tc d' I voire 


KP 


Democratic People's ^ 


NZ 


New Zealand 






CM 


Cameroon 




Republic of Korea 


PL 


Poland 






CN 


China 


KR 


Republic of Korea 


PT 


Portugal 






CU 


Cuba 


KZ 


Kazakstan 


RO 


Romania 






CZ 


Czech Republic 


tx: 


Saim Luda 


RU 


Russian Federation 






DE . 


Germany 


u 


Liechtenstein 


SD 


Sudan 






DK 


Denmark 


LK 


Sri Lanka 


SE 


Sweden 






EE 


Estonia 


LR 


Liberia 


SG 


Singapore 







wo 99/10535 



PCT/US98/17283 



A PROCESS TO STUDY CHANGES 
IN GENE EXPRESSION IN STEM CELLS 



Tpf-.hnjc.a1 Field 

This invention relates to compositions and methods useful to identify agents that 
modulate the expression of at least one gene associated with the differentiation, 
proliferation, dedication and/or survival of stem cells. 

5 7^ackp^oun '^ the Invention 

The identification of genes associated with development and differentiation of 
cells is an important step for advancing our understanding of hematopoiesis, the 
differentiation of hematopoietic stem cells into erythrocytes, monocytes, platelets and 
polymorphonuclear white hlood cells or granulocytes. The identification of genes 

10 associated with hematopoiesis is also an important step for advancing the development of 
therapeutic agents which modulate, promote or interfere with the differentiation of stem 
cells. 

Hematopoietic stem cells derive from bone marrow stem cells. The bone marrow 
stem cells ultimately differentiate into the hematopoietic stem cells, which are 
15 responsible for the lymphoid, myeloid and erythroid lineages, and stromal stem cells, 
which differentiate into fibroblasts, osteoblasts, smooth muscle cells, stromal cells and 
adipocytes (Stewart Sell. Immunology, Immunopathology & Immunity, 5th ed. 39- 
42 Stamford, CT, 1996). The lymphoid lineage, comprising B-cells and T-cells, provides 
for the production of antibodies, regulation of the cellular immune system, detection of 
20 foreignagentsintheblood.detectionofcellsforeigntothehost.andthelike. The 
myeloid lineage, which includes monocytes, granulocytes, megakaryocytes as well as 
others cells, monitors for the presence of foreign bodies in the blood stream, provides 
protection against neoplastic cells, scavenges foreign materials in the blood stream. 



wo 99/10535 



PCT/US98/17283 



-2- 

produces platelets and the like. The erythroid lineage provides the red blood cells which 
act as oxygen carriers. 

Hematopoietic stem cells differentiate as a result from their interaction with 
growth factors such as interleukins (ILs), lymphokines, colony-stimulating factors 
5 (CSFs), erythropoietin (epo), and stem cell factor (SCF). Each of these growth factors 
have multiple actions that are not necessarily limited to the hematopoietic system 
(Robert A. Meyers, ed., Molecular Biology and Biotechnology: A 
Comprehensive Desk Reference, 392-6, New York, 1995). Proliferation, 
differentiation and survival of inmiature hematopoietic progenitor cells are sustained by 
10 hematopoietic growth factors (hemopoietins). These grov^h factors also influence the 
survival and function of mature blood cells. The kinetics of hematopoiesis vary 
depending on cell type, and their life span may be as little as 6-12 hours to as much as 
months or years. As a result, the daily renewal of certain lymphocyte progenitors may be 
substantially lower than that of leukocytic progenitors. The most primitive cells, 
1 5 pluripotent stem cells (PSCs), have high self-renewal capacity (Nathan, 8 1 8-82 1 ; Saito, 
Recent trends in research on differentiation of hematopoietic cells and lymphokines. 
Hum. Cell. 5(n: 54 (1992)). 

Growth factors are responsible for differentiating the hematopoietic stem cell into 
either the hemocytoblast, which is the progenitor cell of erythrocytes, neutrophils, 
20 eosinophils, basophils, monocytes and platelets, and lymphoid stem cells, which are 
progenitors to T cells and B cells. Sell, 41. These circulating blood cells are products 
of terminal differentiation of recognizable precursors (e.g., erythroblasts, mono- 
myeloblasts and megakaryoblasts, to name but a few). The terminal differentiation of 
these recognizable precursors may occur exclusively in the marrow cavities of the axial 
25 skeleton, with some extension into the proximal femora and humeri (David G. Nathan, 
Hematologic Diseases, IN CECIL TEXTBOOK OF MEDICINE 20th ed., 817, Philadelphia, 
1996). White blood cell (WBC) nomenclature may be divided into two major 
populations on the basis of the form of their nuclei: single nuclei (mononuclear or "round 
cells") or segmented nuclei (polymorphonuclear). 



PCT/US98/17283 

WO 99/10535 



-3- 



In human medicine, the ability to initiate and regulate hematopoiesis is of great 
importance (McCune et al.,The SCID-hu mouse: murine model for the analysis of human 
hcmatolymphoid differentiation and function, Scifinee 241 : 1632(1988)). A variety of 
diseases and immune disorders, including malignancies, appear to be related to 
5 disruptions within the lympho-hematopoietic system. Many of these disorders could be 
aUeviaied and/or cured by repopulating the hematopoietic system with progenitor cells, 
which when triggered to differentiate would overcome the patient's deficiency. In 
humans, a current replacement therapy is bone marrow transplantation. This type of 
therapy, however, is both painfiil (for donor and recipient) because of involvement of 
10 invasive procedures and can offer severe complications to the recipient, particularly when 
the graft is allogeneic and Graft Versus Host Disease (GVHD) results. Therefore, the 
risk of GVHD restricts the use of bone marrow transplantation to patients with otherwise 
fatal diseases. A potentially more exciting alternative therapy for hematopoietic 
disorders is the treatment of patients with reagents that regulate the proliferation and 
15 differentiation of stem cells (Lawman et ai, U.S. Patent No. 5,650.299 (1997)). 

There is also a strong interest in the development of procedures to produce large 
numbers of the human hematopoietic stem cell. This will allow for identification of ^ 
growth factors associated with its self regeneration. Additionally, there may be as yet 
undiscovered grbwth factors associated (1) with the early steps of dedication of the stem 
20 cell to a particular lineage; (2) the prevention of such dedication; and (3) the negative 
control ofst«n cell proliferation. Availability oflarge numbers of stem cells would be 
extremely useful in bone marrow transplantation, as well as transplantation of other 
organs in association with the transplantation of bone marrow. 

An i/i vifro system that permits determination of what agents induce 
25 differentiation or proliferation of progenitor cells within a hematopoietic cell population 
would have many applications. For example, controlled production of red blood cells 
would permit the in vitro production of red blood cell units for clinical replacement 
(transfiision) therapy. As is well known, transfused red cells are used in the treatment of 
anemia following elective surgery, in cases of traumatic blood loss, and in the supportive 
30 care of, e.g. , cancer patients. Similarly, controlled production of platelets would permit 



wo 99/10535 



PCT/US98/17283 



-4- 

the in vitro production of platelets for platelet transfusion therapy, which may be used in 
cancer patients with thrombocytopenia caused by chemotherapy. For both red cells and 
platelets, current volunteer donor pools are accompanied by the risk of infectious 
contamination, and availability of an adequate supply can be limited. Determination of 

5 such compounds would lend itself to developing methods of controlled in vitro 
production of specified lineage of mature blood cells to circumvent these problems 
(Palsson et al, U.S. Patent No. 5,635,386 (1997)). 

Alternatively, agents could be isolated that selectively deplete a particular lineage 
of cells from within a hematopoietic cell population and can similarly confer important - 

10 advantages. For example, production of stem cells and myeloid cells while selectively 
depleting T-cells from a bone marrow cell population could be very important for the 
management of patients with human immimodeficiency virus (HIV) infection. Since the 
major reservoir of HIV is the pool of mature T-cells, selective eradication of the mature 
T-cells from a hematopoietic cell mass collected from a patient has considerable potential 

15 therapeutic benefit. If one could selectively remove all the mature T-cells from within an 
HIV infected bone marrow cell population while maintaining viable stem cells, the T-cell 
depleted bone marrow sample could then be used to "rescue" the patient following 
hematolymphoid ablation and autologous bone marrow transplantation. Although there 
are reports of the isolation of progenitor cells (see, e.g:^ Tsukamoto et al.^ (1991) as 

20 representative) such techniques are distinct from the selective removal of T-cells from a 
hematopoietic tissue culture (Palsson et al, U.S. Patent No. 5,635,386 (1997)). 

Summary of the Invention 

While the differentiation of stem cells has been the subject of intense study, httle 
is known about the global transcriptional response of stem cells during cell 
25 hematopoiesis. The present inventors have devised an approach to systematically assess 
the transcriptional regulation of stem cells during hematopoiesis as well as methods for 
the identification of agents that modulate the expression of at least one gene associated 
with hematopoiesis. 



wo 99/10535 



PCTAJS98/17283 



-5- 



The present invention includes a method to identify stem cell genes that are 
differentially expressed in stem cells at various stages of differentiation when compared 
to undifferentiated stem cells by preparing a gene expression profile of a stem cell 
population and comparing the profile to a profile prepared from stem cells at different 
5 stages of differentiation, thereby identifying cDNA species, and therefore genes, which 
are expressed. 

The present invention fiirther includes a method to identify an agent that 
modulates the expression of at least one stem cell gene associated with the differentiation 
process of a stem cell population, comprising the steps of preparing a first gene 
10 expression profile of an undifferentiated stem cell population, preparing a second gene 
expression profile of a stem cell population at a defined stage of differehtiation, treating 
said undifferentiated stem cell population with the agent, preparing a third gene 
expression profile of the treated stem cell population, and comparing the first, second and 
third gene expression profiles. Comparison of the three gene expression profiles for - 
1 5 RNA species as represented by cDNA fragmerits that are differentially expressed upon 
addition of the agent to the undifferentiated stem cell population identifies agents that 
modulate the expression of at least one gene in undifferentiated stem cells that is 
associated with stem cell differentiation. 

Another aspect of the invention is a composition comprising a grouping of nucleic 
acids or nucleic acid fragments affixed to a solid support. The nucleic acids affixed to 
the solid support correspond to one or more genes whose expression levels are modulated 
during stem cell differentiation. 



20 



Brief Description of th e Drawings 

Fig. 1 Figure 1 is an autoradiogram of the gene expression profiles generated 
25 fi-om cDNAs made with RNA isolated from Lin*. LRH, LRH48 and LRBRH cells. A 
possible 12 anchoring oligo d(T)nl. n2 were used to generate a complete expression 
profile for the enzyme Clal. 



wo 99/10535 



PCTAJS98/17283 



-6- 

Modcs of Carrying Out the Invention 
General Description 

The differentiation of stem cells during the process of hematopoiesis is a subject 
of primary importance in view of the need to find ways to modulate the stem cell 
5 differentiation process. One means of characterizing the process of hematopoiesis is to 
measure the ability of stem cells to synthesize specific RNA during stem cell 
difTcrcnlialion. 

The following discussion presents a general description of the invention as well 
definitions for certain terms used herein. 

10 Definitions 

The term "stem cells" as used herein, refers to both hematopoietic stem cells and 
bone marrow stem cells, and includes totipotent cells which serve as progenitors of 
neoplastic transformation. The term "hematopoietic stem cells" refers to stem cells 
which differentiate into erythrocytes, monocytes, granulocytes, and platelets. The 
15 putative human hematopoietic stem cell may express the cell surface antigen CD34. 
: The term "hematopoiesis " as used herein, refers to the process by which stem cells 
differentiate into blood cells, including erythrocytes, monocytes, granulocytes, and 
platelets. 

The term "blood cell", as used herein, refers to all blood cell types derived fi-om the 
20 process of hematopoiesis (see Stewart Sell, Immunology, Immunopa thology & 
Immunity, 5th ed. 39-42, Stamford, CT, 1996) 

• The term "solid support", as used herein, refers to any support to which nucleic acids 
can be bound or immobilized, including nitrocellulose, nylon, glass, other solid supports 
which are positively charged and nanochannel glass arrays disclosed by Beattie (WO 
25 95/1175). 

The term "gene expression profile", also referred to as a "differential expression 
profile" or "expression profile" refers to any representation of the expression level of at 



wo 99/10535 PCT/US98/17283 



least one mRNA species in a cell sample or population. For instance, a gene expression 
profile can refer to an autoradiograph of labeled cDNA fragments produced from total 
cellular mRNA separated on the basis of size by known procedures. Such procedures 
include slab gel electrophoresis, capillary gene electrophoresis, high performance liquid 
5 chromatography, and the like. Digitized representations of scanned electrophoresis gels 
are also included as are two and three dimensional representations of the digitized data. 

While a gene expression profile encompasses a representation of the expression level 
of at least one mRNA species, in practice, the typical gene expression profile represents 
the expression level of multiple mRNA species. For instance, a gene expression profile 
1 0 useful in the methods and compositions disclosed herein represents the expression levels 
of at least about 5, 10, 20, 50, 100 , 150, 200, 300, 500, 1000 or more preferably, 
substantially all of the detectable mRNA species in a cell sample or population. 
Particularly preferred are gene expression profiles or arrays affixed to a solid support that 
contain a sufficient representative number of mRNA species whose expression levels are 
1 5 modulated under the relevant infection, disease, screening, treatment or other 

experimental conditions. In some instances a sufficient representative number of such 
mRNA species will be about 1, 2, 5, 10, 15, 20, 25, 30, 40, 50, 50-75 or 100. 

Gene expression profiles can be produced by any means known in the art, including, 
but not limited to the methods disclosed by: Prashar et al. (1996) Proc. Natl. Acad. Sci. 
20 USA 93:659-663; Liang et al. (1992) Science 257:967-971 ; Ivanova et al. (1995) Nucleic 
Acids Res. 23:2954-2958; Guilfoyl et al. (1997) Nucleic Acids Res. 25(9): 1854-1 858; 
Chee et al. (1996) Science 274:610-614; Velculescu et al. (1995) Science 270:484-487; 
Fischer et al. (1995) Proc. Natl. Acad Sci. USA 92(12):5331-5335; and Kato (1995) 
Nucleic Acids Res. 23ilZ):36S5-3690. 
25 As an example, gene expression profiles are made to identify one oi: more genes 
whose expression levels are modulated during the process of stem cell differentiation. 
The assaying of the modulation of gene expression via the production of a gene 
expression profile generally involves the production of cDNA from polyA* RNA 
(mRNA) isolated from stem cells as described below. 



6NSOCCID: •two e910535A1_IA> 



wo 99/10535 



PCTAJS98/17283 



-8- 

Stem cells are harvested or isolated by any technique known in the art. One of the 
most versatile ways to separate hematopoietic cells is by use of flow cytometry, where 
the particles, Le,. cells, can be detected by fluorescence or light scattering. The source of 
the cells may be any source which is convenient. Thus, various tissues, organs, fluids, or 

5 the like may be the source of the cellular mixtures. Of particular interest are bone 

marrow and peripheral blood, although other lymphoid tissues are also of interest, such as 
spleen, thymus, and lymph node (see Sasaki et aL, U.S. Patent No. 5,466,572 and Fei et 
a/., U.S. Patent No. 5,635,387). 

Cells of interest will usually be detected and separated by virtue of surface membrane 

10 proteins which are characteristic of the cells. For example, CD34 is a marker for 

immature hematopoietic cells. Markers for dedicated cells may include CD 10, CD 19, 
CD20, and sig for B cells, CD 15 for granulocytes, CD 16 and CD33 for myeloid cells, 
CD 14 for monocytes, CD41 for megakaryocytes, CD38 for lineage dedicated cells, CD3, 
CD4, CD7, CD8 and T cell receptor (TCR) for T cells, Thy-1 for progenitor cells, 

15 glycophorin for erythroid progenitors and CD71 for activated T cells. In isolating early 
progenitors, one may divide a CD34 positive enriched fraction into lineage (Lin) 
negative, e.g. CD2 - , CD 14 - , CD15 - , CD16 - , CDIO - , CD19 - , CD33 - and 
glycophorin A - , fractions by negatively selecting for markers expressed on lineage 
committed cells, Thy-1 positive fractions, or into CD38 negative fractions to provide a 

20 composition substantially enriched for early progenitor cells. Other markers of interest 
include V alpha and V beta chains of the T-cell receptor (Sasaki et al, U. S. Patent No. 
5,466,572(1995)). 

After isolation of the appropriate stem cells, total cellular mRNA is isolated from the 
cell sample. mRNAs are isolated from cells by any one of a variety of techniques. 

25 Numerous techniques are well known {see e.., Sambrook et al.. Molecular Cloning: A 
Laboratory Approach, Cold Spring harbor Press, NY, 1987; Ausbel et.. Current 
Protocols in Molecular Biology, Greene Publishing Co. NY, 1995). In general, these 
techniques first lyse the cells and then enrich for or purify RNA. In one such protocol, 
cells are lysed in a Tris-buffered solution containing SDS. The lysate is extracted with 

30 phenol/chloroform, and nucleic acids precipitated. The mRNAs may be purified from 



wo 99/10535 



PCT/US98/17283 



crude preparations of nucleic adds or from total RNA by chromatography, such as 
binding and elution from oligo(dT)-cellulose or poly(U)-Sepharose®. However, 
purification of poly(A)-containing RNA is not a requirement. As stated above, other 
protocols and methods for isolation of RNAs may be substituted. 
5 The mRNAs are reverse transcribed using an RNA-directed DNA polymerase, such as 
reverse transcriptase isolated from AMV. MoMuLV or recombinantly produced. Many 
cormnercial sources of enzyme are available {e.g. Pharmacia, New England Biolabs, 
Stratagene Cloning Systems). Suitable buffets., cofactors, and conditions are well known 
and supplied by manufacturers {see also, Sambrook al. (1989) Molecular Cloning: a 
10 laboratory manual 2nd Ed.. Cold Spring Harbor Laboratory; and Ausbel et ai. (1987) 
Current Protocol in Molecular Biology,GrecncV^xh\ish\ng2ndW^ 

N.Y.). 

Various oligonucleotides are used in the production of cDNA. In particular, the 
methods utilize oligonucleotide primers for cDNA synthesis, adapters, and primers for ' 
15 amplification. Oligonucleotides are generally synthesized so single strands by standard 
chemistry techniques, including automated synthesis. Oligonucleotides are subsequently 
de-protected and may be purified by precipitation with ethanol, chromatographed using a 
sized or reversed-phase column, denaturing polyacrylamide gel electrophoresis, high^ 

pressure liquid chromatography (HPLC), or other suitable method. In addition, within 
20 certain preferred embodiments, a functional group, such as biotin. is incorporated 

preferably at the 5' or 3' terminal nucleotide. A biotinylated oligonucleotide may be 
synthesized using pre-coupled nucleotides, or alternatively, biotin may be conjugated to 
the oligonucleotide using standard chemical reactions. Other functional groups, such as 
florescent dyes, radioactive molecules, digoxigenin. and the like, may also be 
25 incorporated. 

Partially-double stranded adaptors are formed from single stranded oligonucleotides 
by annealing complementary single-stranded oligonucleotides that are chemically • 
synthesized or by enzymatic synthesis. Following synthesis of each strand, the two 
oligonucleotide strands are mixed together in a buffered salt solution {e.g.. 1 M NaCl, 
30 100 mM Tris-HCl pH.8.0, 10 mM EDTA) or in a buffered solution containing Mg*^ {e.g.. 



wo 99/10535 



PCT/US98/17283 



-10- 

10 mM MgCl2) and annealed by heating to high temperature and slow cooling to room 
temperature. 

The oligonucleotide primer that primes first strand DNA synthesis may comprise a 5* 
sequence incapable of hybridizing to a polyA tail of the mRNAs, and a 3' sequence that 
5 hybridizes to a portion of the polyA tail of the mRNAs and at least one non-polyA 
nucleotide immediately upstream of the polyA tail. The 5* sequence is preferably a 
sufficient length that can serve as a primer for amplification. The 5' sequence also 
preferably has an average G+C content and does not contain large palindromic sequence; 
some palindromes, such as a recognition sequence for a restriction enzyme, may be 
10 acceptable. Examples of suitable 5* sequences are CTCTCAAGGATCTACCGCT (SEQ 

ID No. ), CAGGGTAGACGACGCTACGC (SEQ ID No. ), and 

TAATACCGCGCCACATAGCA(SEQIDNo._ ) 

The 5' sequence is joined to a 3* sequence comprising sequence that hybridizes to a 
portion of the polyA tail of mRNAs and at least one non-polyA nucleotide immediately 
1 5 upstream. Although the polyA-hybridizing sequence is typically a homopolymer of dT 
or dU, it need only contain a sufficient number of dT or dU bases to hybridize to polyA 
under the conditions employed. Both oligo-dT and oligo-dU primers have been used and 
give comparable results. Thus, other bases may be interspersed or concentrated, as long 
as hybridization is not impeded. Typically, 12 to 18 bases or 12 to 30 bases of dT or dU 
20 will be used. However, as one skilled in the art appreciates, the length need only be 
sufficient to obtain hybridization. The non-poly A"" nucleotide is A, C, or G, or a 
nucleotide derivative, such as inosinate. If one non-polyA nucleotide is used, then three 
oligonucleotide primers are needed to hybridize to all mRNAs. If two non-polyA 
nucleotides are used, then 12 primers are needed to hybridize to all mRNAs (AA, AC, 
25 AG, AT, CA, CC, CG, CT, GA, GC, GG, GT). If three non-poly A nucleotides are used 
then 48 primers are needed (3 X 4 X 4). Although there is no theoretical upper limit on 
the number of non-polyA nucleotides, practical considerations make the use of one or 
two non-polyA nucleotides preferable. 

For cDNA synthesis, the mRNAs are either subdivided into three (if one non-polyA 
30 nucleotide is used) or 12 (if two non-polyA nucleotides are used) firactions, each 



wo 99/10535 



PCT/US98/17283 



-11- 



containing a single oligonucleotide primer, or the primers may be pooled and contacted 
with a mRNA preparation. Other subdivisions may altematively be used. Briefly, first 
strand cDNA is initiated from the oligonucleotide primer by reverse transcriptase 
(RTase). As noted above, RASE may be obtained from numerous sources and protocols 
5 are well known. Second strand synthesis may be performed by RASE (Gubler and 

Hoffman, Gene 25: 263, 1983). which also has a DNA-directed DNA polymerase 
activity, with or without a specific primer, by DNA polymerase 1 in conjunction with 
RNaseH and DNA Hgase. or other equivalent methods. The double-stranded cDNA is 
generally treated by phenohchloroform extraction and ethanol precipitation to remove 

10 protein and free nucleotides. 

Double-stranded cDNA is subsequently digested with an agent that cleaves in a 

sequence-specific manner. Such cleaving agents include restriction enzymes, chemical 
cleaving agents, triple helix, and any other cleaving agent available. Restriction enzyme 
digestion is preferred; enzymes that are relatively infrequent cutters {e.g., ^ 5 bp 
15 recognition site) are preferred and those that leave overhanging ends are especially 

preferred. A restriction enzyme with a six base pair recognition site cuts approximately 
8% of cDNAs, so that approximately 12 such restriction enzymes should be needed to 
digest every cDNA at least once. By using 30 restriction enzymes, digestion of eveiy 

cDNA is assured. 

20 The adapters for use in the present invention are designed such that the two strands 
are only partially complementary and only one of the nucleic acid strands that the adapter 
is ligated to can be amplified. Thus, the adapter is partially double-stranded (i.e., 
comprising two partially hybridized nucleic acid strands), wherein portions of the two 
strands are non-complementary to each other and portions of the two strands are 

25 complementary to each other. Conceptually, the adapter may be "Y-shaped" or "bubble- 
shaped." When the 5' region is non-paired, the 3' end of other strand cannot be extended 
by a polymerase to make a complementary copy. The ligated adapter can also be blocked 
at the 3' end to eliminate extension during subsequent ainphfications. Blocking groups 
include dideoxynucleotides and other available blocking agents. In this type of adapter 

30 ("Y-shaped"), the non-complementary portion of the upper strand of the adapters is 



wo 99/10535 



PCTAJS98/17283 



-12- 

preferably a length that can serve as a primer for amplification. As noted above, the non- 
complementary portion of the lov/cr strand need only be one base, however, a longer 
sequence is preferable (e.g., 3 to 20 bases; 3 to 15 bases; 5 to 15 bases, or 14 to 24 bases. 
The complementary portion of the adapter should be long enough to form a duplex under 

5. conditions of ligation. 

For "bubble-shaped" adapters, the non-complementary portion of the upper strands is 
preferably a length that can serve as a primer for amplification. Thus, this portion is 
preferably 15 to 30 bases. Alternatively, the adapter can have a structure similar to the 
Y-shaped adapter, but has a 3* end that contains a moiety that a DNA polymerase cannot 

1 0 extend from. 

Amplification primers are also used in the present invention. Two different 
amplification steps are performed in the preferred aspect. In the first, the 3* end 
(referenced to mRNA) of double stranded cDNA that has been cleaved and ligated with 
an adapter is amplified. For this amplification, either a single primer or a primer pair is 

15 used. The sequence of the single primer comprises at least a portion of the 5' sequence of 
the oligonucleotide primer used for first strand cDNA synthesis. The portion need only 
be long enough to serve as an amplification primer. The primer pair consists of a first 
primer whose sequence comprises at least a portion of the 5' sequence of the 
oligonucleotide primer as described above; and a second primer whose sequence 

20 comprises at least a portion of the sequence of one strand of the adapter in the non- 
complementary portion. The primer will generally contain all the sequence of the non- 
complementary potion, but may contain less of the sequence, especially when the non- 
complementary portion is very long, or more of the sequence, especially when the non- 
complementary portion is very short. In some embodiments, the primer will contain 

25 sequence of the complementary portion, as long as that sequence does not appreciably 
hybridize to the other strand of the adapter under the amplification conditions employed. 
For example, in one embodiment, the primer sequence comprises four bases of the 
complementary region to yield a 19 base primer, and amplification cycles are performed 
at 56°C (annealing temperature), 72°C (extension temperature), and 94°C (denaturation 

30 temperature). In another embodiment, the primer is 25 bases long and has 10 bases of 



wo 99/10535 



PCTAJS98/17283 



-13- 



sequence in the complementary portion. Amplification cycles for this primer are 
performed at 68 °C (annealing and extension temperature) and 94''C (denaturation 
temperature). By using these longer primers, the specificity of priming is increased. 
The design of the amplification primers will generally follow well-known guidelines, 
5 such as average G-C content, absence of hairpin structures, inability to form primer- 
dimers and the like. At times, however, it will be recognized that deviations from such 
guidelines may be appropriate or desirable. 

In instances where small numbers of cells are available for the initial RNA extraction, 
such as small numbers of stem cells, the preferred method of producing a gene expression 
10 profile comprises the following general steps. Total RNA is extracted from as few as 
5000 stem cells. Using an oligo-dT primer, double stranded cDNA is synthesized and 
ligated to an adapter in accordance with the present invention. Using adapter primers, the 
cDNA is PGR amplified using the protocol of Baskaran and Weissman (1996) Genome 
Research 6(7): 633 and/or Liv et al. (1992) Methods ofEnzymology. The original cDNA 
15 is therefore ampUfied several fold so that a large quantity of this cDNA is available for 
use in the display protocol according to the present invention. For the display, an aliquot 
of this cDNA is incubated with an anchored oligo-dT primer. In one method, this 
mixture is first heat denatured and then allowed to remain at 50»C for 5 minutes to allow 

the anchor nucleotides of the oligo-dT primers to anneal. This provides for the synthesis 
20 ofcDNA utilizing KlenowDNA polymerase. The 3 '-end region of the parent cDNA 
(mainly the polyA region) that remains single stranded due to pairing and subsequent 
synthesis of cDNA by the anchored oligo-dT primer at the beginning of the polyA region, 
is removed by the 5'-3' exonuclease activity of the T4 DNA polymerase. Following 
incubation of the cDNA with T4 DNA polymerase for this purpose. dNTPs are added in 
25 the reaction mixture so that the T4 DNA polymerase initiates synthesis of the DNA over 
the anchored oligo-dT primer carrying the heel. The net result of this protocol is that-the 
cDNA with the 3' heel is synthesized for display from the double stranded cDNA as the 
starting material, rather than RNA as the starting material as occurs in conventional 3 '- 
end cDNA display protocol. The cDNA carrying the 3'-end heel is then subjected to 
30 restriction enzyme digestion, ligation, and PGR amplification followed by running the 



wo 99/10535 



PCT/US98/17283 



-14- 

PCR amplified 3 '-end restriction fragments with the Y-shaped adapter on a display gel. 
An alternate method is presented in Example 1 . 

After amplification, the lengths of the amplified fragments are determined. Any 
procedure that separates nucleic acids on the basis of size and allows detection or 
5 ' identification pf the nucleic acids is acceptable. Such procedures include slab gel 
electrophoresis, capillary gel electrophoresis, 2-dimensional electrophoresis, high 
performance liquid chromatography, and the like. 

Electrophoresis is technique based on the mobility of DNA in an electric field. 
Negatively charged DNA migrates towards a positive electrode at a rate dependent on 
10 their total charge, size, and shape. Most often, DNA is electrophoresed in agarose or 
polyacrylamide gels. For maximal resolution, polyacrylamide is preferred and for 
maximal linearity, a denaturant, such as urea is present. A typical gel setup uses a 19:1 
mixture of acrylamide:bisacrylamide and a Tris-borate buffer. DNA samples are 
denatured and applied to the gel, which is usually sandwiched between glass plates, A 
15 typical procedure can be found in Sambrook et al. (Molecular Cloning: A Laboratory 
Approach, Cold Spring Harbor Press, NY, 1989) or Ausbel et al. {Current Protocols in 
Molecular Biology, Greene Publishing Co., NY, 1995). Variations may be substituted as 
long as sufficient resolution is obtained. 

Capillary electrophoresis (CE) in its various manifestations (free solution, 
20 isotachophoresis, isoelectric focusing, polyacrylamide get. micellar electrokinetic 
"chromatography") allows high resolution separation of very small sample volumes. 
Briefly, in capillary electrophoresis, a neutral coated capillary, such as a 50 /im X 37 cm 
column (eCAP neutral, Beckman Instruments, CA), is filled with a linear polyacrylamide 
(e.g,, 0,2% polyacrylamide), a sample is introduced by high-pressure injection followed 
25 by an injection of running buffer (e.g., IX TBE), The sample is electrophoresed and 

fragments are detected. An order of magnitude increase can be achieved with the use of 
capillary electrophoresis. Capillaries may be used in parallel for increased throughput 
(Smith et al, (1990) Nuc, Acids. Res, 18:4417; Mathies and Huang (1992) Nature 
359:167). Because of the small sample volume that can be loaded onto a capillary, 
30 sample may be concentrated to increase level of detection. One means of concentration 



wo 99/10535 



PCT/US98/17283 



-15- 

is sample stacking (Chien and Burgi (1992) Anal. Chem 64:489A). In sample stacking, a 
large volume of sample in a low concentration buffer is introduced to the capillary 
column. The capillary is then filled with a buffer of the same composition, but at higher 
concentration, such that when the sample ions reach the capillary buffer with a lower 
5 electric field, they stack into a concentrated zone. Sample stacking can increase detection 
by one to three orders of magnitude. Other methods of concentration, such as 
isotachophoresis, may also be used. 

High-performance liquid chromatography (HPLC) is a chromatographic separation 
technique that separates compounds in solution. HPLC instruments consist of a reservoir 
10 of mobile phase, a pump, an injector, a separation column, and a detector. Compounds 
are separated by injecting an aliquot of the sample mixture onto the column! The 
different components in the mixture pass through the column at different rates due to 
differences in their partitioning behavior between the mobile liquid phase and the 
stationary phase. IP-RO-HPLC on non-porous PS/DVB particles with chemically 
15 bonded alkyl chains can also be used to analyze nucleic acid molecules on the basis of 
size (Huberetal. (1993) W^/ocW 121:351; Huberetal. (1993) N«c.^«Vfai2es. 
21:1061; Huber et al. (1993) 5io/ec/i«igMes 16:898). 

In each of these analysis techniques, the amplified fragments are detected. A variety 
of labels can be used to assist in detection. Such labels include, but are not limited to, 
20 radioactive molecules (eg.. "S, "P), fluorescent molecules, and mass spectrometric 
tags. The labels may be attached.to the oligonucleotide primers or to nucleotides that are 
incorporated during DNA synthesis, including ampUfication. 

Radioactive nucleotides may be obtained firom commercial sources; radioactive 
primers may be readily generated by transfer of label from y-'^-ATP to a 5'-OH group 
25 by a kinase {e.g. , T4 polynucleotide kinase). Detection systems include autoradiograph, 
phosphor image analysis and the like. 

Fluorescent nucleotides may be obtained from commercial sources (e.g., ABI, Foster 
city, CA) or generated by chemical reaction using appropriately derivatized dyes. 
Oligonucleotide primers can be labeled, for example, using succinimidyl esters to 
30 conjugate to amine-modified oligonucleotides. A variety of florescent dyes may be used. 



wo 99/10535 



PCT/US98/17283 



-16- 

including 6 carboxyfluorescein, other carboxyfluorescein derivatives, carboxyrhodamine 
derivatives, Texas red derivatives, and the like. Detection systems include 
photomultiplier tubes with appropriate wave-length filters for the dyes used. DNA 
sequence analysis systems, such as produced by ABI (Foster City, CA), may be used. 
5 After separation of the amplified cDNA fragments, cDNA fragments which 
correspond to differentially expressed mRNA species are isolated, reamplified and 
sequenced according to standard procedures. For instance, bands corresponding the 
cDNA fragments can be cut from the electrophoresis gel, reamplified and subcloned into 
any available vector, including pCRscript using the PGR script cloning kit (Stratagene). 

10 The insert is then sequenced using standard procedures, such as cycle sequencing on an 
ABI sequencer (Foster City, CA). 

An additional means of analysis comprises hybridization of the amplified fragments to 
one or more sets of oligonucleotides immobilized on a solid substrate. Historically, the 
solid substrate is a membrane, such as nitrocellulose or nylon. More recently, the 

1 5 substrate is a silicon wafer or a borosilicate slide. The substrate may be porous (Beattie 
et al. WO 95/1 1755) or solid. Oligonucleotides are syntiiesized in situ or synthesized 
prior to deposition on the substrate using standard procedures. Various chemistries are 
known for attaching oligonucleotides. Many of these attachment chemistries rely upon 
functionalizing oligonucleotides to contain a primary amine group. The oligonucleotides 

20 are arranged in an array form, such that the position of each oligonucleotide sequence can 
be determined. 

The amplified fragments, which are generally labeled according to one of the methods 
described herein, are denatured and applied to the oligonucleotides on the substrate under 
appropriate salt and temperature conditions. In certain embodiments, the conditions iare 
25 chosen to favor hybridization of exact complementary matches and disfavor hybridization 
of mismatches. Unhybridized nucleic acids are washed off and the hybridized molecules 
detected, generally both for position and quantity. The detection method will depend 
upon the label used. Radioactive labels, fluorescent labels and mass spectrometry label 
are among the suitable labels. 



PCT/IJS98/17283 

WO 99/10535 



-17- 



The present invention as set forth in the specific embodiments, includes methods to 
identify a therapeutic agent that modulates the expression of at least one stem cell gene 
associated with the differentiation, proliferation and/or survival of stem cells. 

As an example, the method to identify an agent that modulates the expression of at 

5 least one stem cell gene associated with the differentiation of a stem cell population, 
comprises the steps of preparing a first gene expression profile of an undifferentiated 
stem cell population, preparing a second gene expression profile of a stem cell population 
at a defined stage of differentiation, treating said undifferentiated stem cell population 
with the agent, preparing a third gene expression profile of the treated stem cell 

1 0 population, and comparing the first, second and third gene expression profiles. 

Comparison of the three gene expression profiles for RNA species as represented by 
cDNA fragments that are differentially expressed upon addition of the agent to the 
undifferentiated stem cell population identifies agents that modulate the expression of a[- 
least one gene in undifferentiated stem cells that is associated with stem cell 

15 differentiation. 

While the above methods for identifying a therapeutic agent comprise the comparison 
of gene expression profiles from treated and not-treated stem cells, many other variations 
are inuriediately envisioned by one of ordinary skill in the art. As an example, as a 
variation of a method to identify a Aerapeutic agent that modulates the expression of at 
20 least one stem cell gene associated with the differentiation, the second gene expression 
profile of a stem cell population at a defined stage of differentiation and the third gene 
expression profile of the treated stem cell population can each be independently 
normalized using the first gene expression profile prepared from the undifferentiated 
stem cell population. Normalization of the profiles can easily be achieved by scanning 
25 autoradio^phs corresponding to each profile, and subtracting the digitized values 

corresponding to each band on the autoradiograph from undifferentiated stem cells from 
the digitized value for each corresponding band on autoradiographs corresponding to the 
second and third gene expression profiles. After normalization, the second and third gene 
expression profiles can be compared directly to detect cDNA fragments which 



oMQnnnin- -rwn $*9io535Ai 1A> 



wo 99/10535 



PCT/US98/17283 



-18- 

correspond to mRNA species which are specifically expressed during differentiation of a 
stem cell population. 

Specific Embodiments 

Example 1 

5 Production of gene expression profiles generated firom cDNAs made with RNA isolated 
firom undifferentiated and partially differentiated stem cells. 
Crude Marrow Preparation 

Expression profiles of RNA expression levels fi-om undifferentiated stem cells and 
stems cells at various levels of differentiation, including partially differentiated and 

10 terminally differentiated stem cells, offer a powerful means of identifying genes whose 
expression levels are associated with stem cell differentiation or proliferation. As an 
example, the production of expression profiles jfrom murine lineage negative, rhodamine 
low, Hoechst low and rhodamine bright, Hoechst low hematopoietic precursor cells 
allows for the identification of mRNA species and their encoding genes whose 

15 expression levels are associated with stem cell differentiation 

. Hoechst****/Rhodamine*°* hematopoietic stem cells were isolated by sacrificing 30 
Balb/c female mice (6-12 weeks) znd surgically removing the iliac crests, femurs and 
tibiae. The bones were cleaned and placed in 10 ml PBS/5% HI-FBS on ice. One tube 
was used for the bones firom 10 mice. The bones were ground throughly with a pestle 

20 until completely broken. Following grinding, the supernatant was removed into a 50 ml 
conical tube through a 40 \iM filer(Falcon #2340). 10 ml PBS/FBS was added to the mix 
and the supernatant removed. The supematant was then centrifiiged (1250 rpm) for 5-10 
minutes. The supematant which contains a high concentration of lipid was then decanted 
and discarded. 

25 The cells were then pooled into 25 or 50 ml fresh PBS/FBS, and tiny bone fragments 
removed by settling. The cells were then counted in crystal violet. Cells were diluted 
and underlayed with LSM, centrifiiged at 2000ipm(1000xg) for 20 minutes. To harvest 
the buffy coat, the supematant was removed to within 1 cm of the cells. The next 8- 



m 

wo 99/10535 PCT/US98/17283 

-19- 

10ml of medium and cells were harvested by swirling the media aroimd in the tube to 
draw cells from all sides of the gradient. The cell volume was then brought up to 50 ml 
v^th PBS/FBS and spun at 1400rpm 5-10 minutes. 



Lineage Depletion 

5 Cells were counted in Crystal Violet and resuspended in fresh PBS/FBS^ Lineage- 
specific antibodies were added as follows: 

TER 119 0.1 jig/ml final concentration 
B220 15^1/10^ cells 

Mac-1 ISfiVlO^ cells 

10 Gr-1 15pil/10« cells 

Lyt-2 1/20 final dilution 

L3T4 1/20 final dilution 

Yw25.12,7 1/100 final dilution 

The cells were incubated on ice for 15 minutes, brought to a volume of 50ml with - 
15 PBS/FBS and collected at 1400rpm for 5-10 minutes, and washed to remove unbound 
antibodies. 

During the antibody binding step. Magnetic Beads(Dynabeads M-450) were prepared at a 
ratio of 5 beads/cell. The beads were coated with Sheep anti-Rat antibodies that bind to 
the lineage-specific antibodies, which are all of rat origin. When the beads are placed in 
20 a magnetic field, the Lin^ cells are removed. The resulting supernatant contains the Lin- 
population (granulocytes and lymphocyte populations will be substantially depleted or 
absent after this step.) 

Hoechst/Rhodamine Staining 

Rhodamine 123 was added to a final concentration of 0.1 |ig/ml, then incubated at 
25 32°C for 20 minutes in the dark. Without further manipulation or washing, HOECHST 
33342 was added to a final concentration of lOgM then incubated at SV'C for an 
additional hour. The aliquot of crude marrow was brought to 0.5 ml with PBS/FBS and 
Hoechst to this cell preparation as well. The volume was brought to 50 ml with 
PBS/FBS, centrifuged at 1400rpm for 5-10 minutes, supernatant discarded and cells 
30 resuspended to 2x1 0^ cells/ml. The rhodamine only and Hoechst Only/Crude Marrow 



BNSDOCID: <WO 9910535A1_IA> 



wo 99/10535 



PCT/US98/17283 



-20- 

were washed in parallel. These two populations were then resuspended in 0.5ml 
PBS/FBS for flow cytometry analysis 

Total RNA was extracted from approximately 5000 stem cells. Using an oligo-dT 
primer, double stranded cDNA is synthesized and ligated to an adapter in accordance 
5 with the present invention. Using adapter primers, the cDNA is PGR amplified using the 
protocol of Baskaran and Weissman (1996) Genome Research 6(7): 633 and Lie et al.. 

Methods of Enzymology, . The original cDNA is therefore amplified several fold so 

that a large quantity of this cDNA is available for use in the display protocol according to 
the present invention. 
1 0 Synthesis of cDNA for the gene expression profiles was performed as below: 

Materials and Reagents 

A microPoly(A)Pure mRNA Isolation kit (Ambion Inc.) was used for mRNA isolation. 
All the reagents for cDNA synthesis were obtained from Life Technologies Inc. Klentaql 
DNA polymerase (25U//^1) was from Ab peptides Inc. Native Pfu DNA polymerase 

15 (2,5U/a^1) was purchased from Stratagene Inc. Betaine monohydrate was from Fluka 
BioChemica and dimethylsulfoxide (DMSO) was from Sigma Chemical Company. 
Deoxynucleoside triphophates (dNTPs, lOOmM) and bovine serum albxmiin (BSA, 10 
mg/ml) were purchased from New England Biolabs, Inc. Qiaquick PCR purification kit 
(Qiagen) was used to purify the amplified PCR products. The oligonucleotides used in the 

20 Examples were synthesized and gel purified in the DNA synthesis laboratory (Department 
of Pathology, Yale University School of Medicine, New Haven, CT). 

Table 1. Sequences of oligonucleotides. 



T7-SalI-oligo-d(T)V 


5 '-ACG TAA TAG GAC TCA CTA TAG GGC GAA TTG GGT CGA C- 
d (T) ,8 V-3* . where V = A, C, G 


anti-NotI Long 


5'-CTT ACA GCG GGC GCT TGG ACG-3' 



BNSDOCID: <WO 9910535A1_IA> 



wo 99/10535 



PCT/US98/17283 



-21- 



NotI Short 


5'-AGC GGC CGC TGT AAG-S' 


Notl/RI primer 


5'-GCG GAA TTC CGT CCA AGC GGC CGC TGT AAG-3' 



Methods 

I. Preparation of mRNA 

5 MicroPoly(A)Pure mRNA isolation kit was used for the isolation of Poly(A)^ RNA 
following the kit instructions, mRNA from a small number of mouse hematopoietic cells 
(5,000-10,000 cells) was extracted, eluted from the column, and precipitated by adding Oil 
volume of 5M ammonium acetate and 2.5 volumes of chilled ethanol with 2//g glycogen as 
carrier. The tubes were left at -20^*0 overnight. The pellets were collected by centrifiigation 

10 at top speed for 30 minutes, washed with 70% ethanol and air-dried at room temperature. 
The pellets were resuspended in 10/^1 HzO/O.lmM EDTA solution. We observed that the 
dissolved mRNA solution was cloudy due to the leaching of colunm materials, therefore the 
samples were centrifuged at 4°C for 5 minutes. The supernatant was. collected for further 
use. 

15 II. cDNA synthesis 

First strand cDNA synthesis 

The cDNA synthesis reaction (final reaction volume is 20/u\) was carried out as 
described in the instruction manual (Superscript Choice System) provided by Life 
Technologies Inc. For the first strand cDNA synthesis, mRNA (10//1) isolated from a small 
20 number of cells was annealed with 200ng (1/zl) of T7-San-oligo-d(T)V-primer (see Table-1) 
in a 0.5-ml micro centrifiige tube (no stick, US A Scientific Plastics) by heating the tubes at 
65 °C for 5 minutes, followed by quick chilling on ice for 5 minutes. This step was repeated 



<WO e9l0535A1JA> 



wo 99/10535 



PCT/US98/17283 



-22- 

once and the contents were collected at the bottom of the tube by a brief centrifiigation. The 
following components were added to the primer annealed mRNA on ice prior to initiating 
the reaction, 1/^1 of lOmM dNTPs, 4//1 of 5 x first strand buffer [250mM Tris-HCl (pH 8.3), 
375mM KCl, 15mM MgCy, 2yul of lOOmM DTT and 1/^1 of RNase Inhibitor (40U//zl). All 
5 the contents were mixed gently and the tubes were pre-warmed at 45^C for 2 minutes. The 
cDNA synthesis was initiated by adding 200 xmits (1/^1) of Superscript 11 Reverse 
Transcriptase and the incubation continued at 45 °C for 1 hour. 



Second strand cDNA synthesis 

At the end of first strand cDNA synthesis, the tubes were kept on ice. Second 

10 strand cDNA synthesis reaction (final volume is ISOfA) was set up in the same tube on 
ice by adding 91^1 of nuclease free water, 30/il of 5x second strand buffer [lOOmM 
Tris-HCl (pH 6.9), 23mM MgClj, 450mM KCl, 0.75mM (p-NAD^ and 50mM 
ammonium sulfate], 3/il of lOmM dNTPs, 1/^1 of E.coli DNA ligase (10U/a/1), 4/^1 of 
E.coli DNA polymerase I (lOU///!) and 1/zl of E.coli RNase H (2U/Ail). The contents were 

15 mixed gently and the tubes were incubated at 16°C for 2 hours. Following the incubation, 
the tubes were kept on ice, 2/^1 of T4 DNA polymerase (3U/a/1) was added and the 
incubation was continued for another 5 minutes at 16**C, The reaction was stopped by the 
addition of 10//1 of 0.5M EDTA (pH 8.0) and extracted once with equal volume of 
phenol: chloroform 1:1 (v/v) and once with chloroform. The aqueous phase was then 

20 transferred to a new tube and precipitated by adding 0.5 volumes of 7.5M anmioniimi 
acetate (pH 7.6), 2Aig of glycogen (as carrier) and 2.5 volumes of chilled ethanoL The 
samples were left at -20^C for ovemight and the cDNA pellets were collected by 
centrifiigation at top speed for 20 minutes. The pellets were washed once with 70% 
ethanol, air-dried and dissolved in 14^^1 of nuclease free water. 

25 As the amount of cDNA derived firom a small number of cells may be low, it may 

be necessary to amplify the cDNA for further analysis. To imiformly amplify the cDNA, 
an ad^tor (NotI adaptor) was first ligated to both ends of the cDNA. Following adaptor 



BNSUOCID: <WO 9910535AlJA> 



WO 99/10535 PCT/US98/17283 



-23- 

ligation, the cDNAs were amplified with Notl/RI primer (see table J), by a modified 
PCR method using betaine and DMSO. 



Ligation of cDNA with NotI adaptor 

Preparation of NotI adaptor: The NotI adaptor was prepared by annealing 

5 Notl-short and anti-Notl-long oligonucleotides (see Table 1). The anti-Notl-long 

oligonucleotide was phosphorylated to ensure that both the adaptor oligonucleotides are 
ligated to the cDNA. 1/ig of anti-Notl-long was mixed with Ifil of lOx T4 polynucleotide 
kinase buffer [700mM Tris-HCl (pH 7.6), lOOmM MgClj and 50mM DTT], l/zl of 
lOmM adenosine triphosphate (ATP), adjusted the volume to 9^1 with water and the 

1 0 reaction was initiated by adding 1/zl of T4 polynucleotide kinase (10U//il). The tubes were 
incubated at 37°C for 30 minutes and then the enzyme was inactivated at 65°C for 20 : 
minutes. The annealing was carried out by adding the following components to the above 
phosphorylated anti-NotMong: l^g of Notl-short, 2jil of lOx oligo annealing buffer . , 
[lOOmM Tris-HCl (pH 8.0), lOmM EDTA (pH 8.0) and IM NaCl] and water to adjust 

15 the final volume to 20/^1. The sample was heated at 65 °C for 10 minutes and allowed to 
cool down to room temperature. The annealed adaptor was stored at -20 ''C. 

Ligation ofcDNA with annealed NotI adaptor: To set up this reaction, 
14a^1 of cDNA was mixed with lOOng of annealed NotI adaptor in a 0.5-ml micro 
centrifiige tube. To this mixture 2//1 of lOx T4 DNA ligase buffer [500mM Tris-HCl (pH 

20 7.8), lOOmM MgClj, lOOmM DDT, lOmM ATP and 250mg/ml BSA] was added and 
adjusted the volume with water to 18/^1 and mixed gently. The reaction was mitiated by 
adding 2/2l of T4 DNA ligase (400U/Ail) and incubated at le'^C overnight. 

III. cDNA amplification 

A modified betaine-DMSO PCR method (Baskaran et al (1996)) Genome 
25 Research 6:633) was used to uniformly amplify the cDNA with different GC content. 
This method uses the LA system, which combines a highly thermostable form of Taq 
DNA polymerase (Klentaql , which is devoid of 5'-exonuclease activity) and a 
proofi-eading enzyme {Pfu DNA polymerase, which has 3'-exonuclease activity). The 



BNSCXX:iD: <WO 9910535A1_!A> 



wo 99/10535 



PCT/US98/I7283 



-24- 

LA16 enzyme consists of 1 part oiPfu DNA polymerase and 15 parts of KlenTaql DNA 
Polymerase (v/v). The NotI adaptor-ligated cDNA was diluted 10 fold with water. 2 fA of 
this diluted cDNA was used as the template for PGR. The PGR reaction (50/^1 final 
volume) was set up with the following components: 5^1 of lOx PGR buffer [200mM 

5 Tris-HGl (pH 9.0), 160mM ammonium sulfate and 25mM MgGy, 16/^1 of water, 0.8//1 
of BSA (lOmg/ml), 1/^1 of Notl/RI PGR primer (lOOng/ul), 5/zl of 50% DMSO (v/v), 15/zl 
of 5M Betaine and 0.2/zl of LAI 6 enzyme. These components were mixed gently on ice 
and then heated to 95^G for 15 seconds on a PGR machine, and held at 80°G while 5//1 of 
2mM dNTPs were added to start the reaction. The PGR conditions were as follows: Stage 

10 /; 95°G for 15 seconds, 55°G for 1 minute, 68°G for 5 minutes, 5 cycles. Stage 2: 95°G 
for 15 seconds, 60°G for 1 minute, 68°G for 5 minutes, 15 cycles. 

After amplification, cDNA was purified with the Qiaquick PGR purification kit 
(following the instructions provided by the supplier). The purified cDNA was eluted in 
the desired volume of water. 

15 Gene expression profiles were prepared from the purified cDNA as previously 

described by Prashar et al in WO 97/05286 and in Prashar et al (1996) Proc. Natl Acad, 
Set USA 93:659-663. Briefly, the adapter oUgonucleotide sequences were 
GTTAGAGGGGGGGGTTGGAGG, GAATGTGGGGGGGGA or alternatively, 
Al (TAGGGTGCGGGGGAGGGAGGGGGAG) and 

20 A2 (GATGGTGGGGGTGGGGTGTGTGTGGGGGG). When A1/A2 were used, one 
microgram of oligonucleotide A2 was first phosphorylated at the 5' end using T4 
polynucleotide kinase (PNK), After phosphorylation, PNK was heated denatured, and 
1/zg of the oligonucleotide Al was added along with 10^ aimealing buffer (1 M 
NaGl/100 mM Tris-HGl, pH8.0/10 mM EDTA, pH8.0) in a final vol of 20 /il. This 

25 mixture was then heated at 65 °G for 10 min followed by slow cooling to room 

temperature for 30 min, resulting in formation of the Y adapter at a final concentration of 
100 ng/^tl. About 20 ng of the cDNA was digested with 4 units of a restriction enzyme 
such as C/al, Bgl 11, etc. in a final vol of 10 //I for 30 min at 37°G. Two microliters (=4 
ng of digested cDNA) of this reaction mixture was then used for ligation to 100 ng (=50- 

30 fold) of the Y-sh^ed adapter in a final vol of 5/zl for 16 hr at 15**G. After ligation, the 



BNSDOCID: <WO 9910535A1_IA> 



wo 99/10535 PCT/US98/I7283 



-25- 

reaction mixture was diluted with water to a final vol of 80 /2I (adapter ligated cDNA 
concentration, ==50 pg///l) and heated at 65**C for 10 min to denature T4 DNA ligase, and 
2-^\ aliquots (with « 1 00 pg of cDNA) were used for PGR. 

The following sets of primers were used for PGR amplification of the adapter 
5 ligated 3 ' -end cDNAs: GGGGAATTGCGTGCAAGGGGCGGCTGTAAG or 
alternatively, RP 5.0 (CTCTCAAGGATCTTACCGCTT jgAT), RP 6.0 
(TAATACCGCGCCACATAGCAT igCG), or RP 9.2 

(CAGGGTAGACGACGCTACGCTigGA) were used as 3' primer while Al.l 
(TAGCGTCCGGCGCAGCGAC) served as the 5' primer. To detect the PGR products 
10 on the display gel, 24 pmol of oligonucleotide Al.l was 5' -end-labeled using 15 p.\ of 
[Y-32 pjaTP (Amersham; 3000 Ci/mmol) and PNK in a final volume of 20 /zl for 30 min 
at ST'C. After heat denaturing PNK at 65 ""C for 20 min, the labeled oligonucleotide was 
diluted to a final concentration of 2 fuM in 80 /j\ with unlabeled oligonucleotide Al.l, ' 
The PGR mixture (20/^1) consisted of 2 a^I (^ 1 00 pg) of the template, 2/il of 1 Ox PGR 
15 buffer (100 mM Tris HCl, pH 8.3/500 mM KCl), 2 /zl of 1 5 mM MgClz to yield 1 .5 mM 
final Mg^* concentration optimum in the reaction mixture, 200 /zM dNTPs, 200 nM each 
5' and 3' PGR primers, and 1 unit of Amplitaq. Primers and dNTPs were added after 
preheating the reaction mixture containing the rest of the components at 85 °C. This "hot 
start" PGR was done to avoid artefactual amplification arising out of arbitrary annealing 
20 of PGR primers at lower temperature during transition firom room temperature to 94''C in 
the first PGR cycle. PGR consisted of 28-30 cycles of 94°C for 30 sec, 50°C for 2 min, 
and 72 ''C for 30 sec. A higher number of cycles resulted in smeary gel patterns. PGR 
products (2.5^1) were analyzed on 6% polyacrylamide sequencmg gel. For double or 
multiple digestion following adapter ligation, 13.2 /A of the ligated cDNA sample was 
25 digested with a secondary restriction enzyme(s) in a final vol of 20 /zl. From this 

solution, 3/zl was used as template for PGR. This template vol of 3 ^\ carried ^ 100 pg 
of the cDNA and 10 mM MgClj (fi-om the lOx enzyme buffer), which diluted to the 
optimum of 1 .5 mM in the final PGR vol of 20 /zl. Since Mg^"" comes fi-om the 
restriction enzyme buffer, it was not included in the reaction mixture when amplifying 
30 secondarily cut cDNA, Bands may then be extracted fi^om the display gels as described 



BNSDOCID: <WO 9910535A1_IA> 



wo 99/10535 



PCT/US98/17283 



-26- 

by Liang et al. (1995 Curr, Opin. Immunol 7:274-280), reamplified using the 5' and 3' 
primers, and subcloned into pCR-Script with high efficiency using the PCR-Script 
cloning kit from Stratagene. Plasmids were sequenced by cycle sequencing on an ABI 
automated sequencer. 

5 Figure 1 presents an autoradiogram of the gene expression profiles generated 

from cDNAs made with RNA isolated from Lin"", LRH, LRH48 and LRBRH cells. All 
possible 12 anchoring oligo d(T)nl, n2 were used to generate a complete expression 
profile for the enzyme C/aL 

Table 2 presents the sequences of numerous differentially expressed bands from 
10 expression profiles made from LIN^, LRH, LRH48 and LRBRH. 

Table 3 presents the expression patterns of the differentially expressed bands set 
forth in Table 2, The band fragment length (size) in Table 3 is the length before 
unwanted terminal sequences were removed. Table 3 also presents the results of a 
GenBank Search and analysis of the sequences of Table 2. 



BNSDOCID: <:WO 9910535A1JA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/17283 



-27- 



E 

c 



e 

e 

e 

e 



t5 

E 
E 



e 



e 



o 



I 



1 



* 



I 



I 



5 



r4 



CO 



«3 

< 

1 

li 



CM 



s 



I 



CM 



I 



CI 

g 
cn 



I 



CM 



I 



V) 



<0 



1 



CM 



I 



£ 



I 



CO 



s 



ft 



S 



5? 



CM 

d 
o 

6 

CO 
X 



c 



I 



a> 



I 



2 



I 



5 



O 

S 



;2i 



s 



BNSCXX;iD: <WO 991053&A1_1A> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



PCT/LIS98/I7283 



-28- 



E 
m 

CD 

& 



S 



Ui 



11 

c 
a 

is 



I 



m 
fa 

0) 



o 

I 



2 



CI. 

ai 

UJ 

I 

a 



l4 



1 

in 
o 



8 



8. 



<0 

Z 



o 

V) 

"5 
E 

40 



4) 



TO 



a. 



o 

I 



f9 



J2 

w 

0 



u 



C 
c 



E 

c 



CM 



CM 



CM 



CM 



CM 



CM 



CO 



c 
e 



E 



I 



I 



II 



I 



S 4 

2 ^ 



c 



o 
o 



o 
o 



< 



<0 



5 



ca 



55 e 



CM 



CM 



o 

2: 



CM 



CO 

9 
o 
o 
a 

CO 

iX 



CM 



CD 



C/5 



CM 



00 



BNSCXX;iD: <WO 991053SA1_IA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



-29- 



PCT/US98/17283 



< 



e 



-2 ^ 



col 



5, ^ 



CO 

cri 



CD 

I 



s 

o 



1 2 



£\ 



cdI 



s 
s 



ii 



o 

fsi 

ll 



< 

111 



'£ 

w 



c 



c 
e 



E 
E 

3 

CO 



CM I CM 



CM 



CO 



CO' 



o o 



CM 



CMl CM 



cmI cmI to 



CM 



CM 



CM 



CM 



c wo 



5 



Is 



I 



I 



1 J 



2 SdIo 



5 



5^ 5 



E 
c 



«! «| 
o o 



2* 



S ^ 2 



CM 



CD 
CM 



CD 



to 



e 



CO 



O 
X 




BNSDOCID: <WO 991053SA1_IA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/17283 



-30- 



As is apparent to one of ordinary skill in the art, this same procedure can be used 
to identify stem cells genes whose expression levels are associated with stem cell 
proliferation, dedicated differentiation and survival. 

5 Example 2 

Method !o identify a therapeutic agent that modulates the expression of at least one stem 

cell gene associated with the differentiation process of a stem cell population. 

The methods set forth in Example 1 offer a powerful approach for identifying 

therapeutic agents that modulate the expression of at least one stem cell gene associated 
10 vyith the differentiation process of a stem cell population. For instance, gene expression 
. profiles of undifferentiated stem cells and partially differentiated or terminally 

differentiated stem cells are prepared as set forth in Example 1. A profile is also prepared 

from an undifferentiated stem cell sample that has been exposed to the agent to be tested. 

By examining for differences in the intensity of individual bands between the three 
15 profiles, agents which up or down regulate genes associated with the differentiation 

process of a stem cell population are identified. 

Example 3 

Method to identify a therapeutic agent that modulates the expression of at least one stem 
20 cell gene associated with the proliferation of a stem cell population. - 
The methods set forth in Example 1 offer a powerful approach for identifying 
therapeutic agents that modulate the expression of at least one stem cell gene associated 
with the proliferation of a stem cell population. For instance, gene expression profiles of 
undifferentiated stem cells and actively proliferating stem cells are prepared as. set forth 
25 in Example 1. A profile is also prepared from an imdifferentiated stem cell sample that 
has been exposed to the agent to be tested. By examining for differences in the intensity 
of individual bands between the three profiles, agents which up or down regulate genes 
associated with the proUferation of a stem cell population are identified. 



BNSDCXID <WO 9910535A1_IA> 



SUBSTITUTE SHEET (RULE 25) 



wo 99/10535 PCT/US98/17283 



-31- 

As is apparent to one of ordinary skill in the art, this same procedure can be used 
to identify stem cells genes whose expression levels are associated with stem cell 
dedicated differentiation and survival. 



Example 4 

5 Production of solid support compositions comprising groupings of nucleic acids or 
nucleic acid fragments that correspond to genes whose expression levels are associated 
with the differentiation, proliferation, dedicated differentiation or survival of stem cells. 

As set forth in Example 1, expression profiles prepared from stem cells at 
different stages of differentiation, from proliferating stem cells, from stem cells that are 

10 dedicated to a differentiation pathway and from stem cells resistant to apoptosis (which 
may be linked to increased survival) provide a means to identify genes whose expression 
levels are associated with stem cell differentiation, proliferation, dedicated differentiation 
and survival, respectively. 

Solid supports can be prepared that comprise immobilized representative 

15 groupings of nucleic acids or nucleic acid fragments corresponding to the genes from 
stem cells whose expression levels are modulated during stem cell differentiation, 
proliferation, dedicated differentiation and siirvival. For instance, representative nucleic 
acids can be immobilized to any solid support to which nucleic acids can be inmiobilized, 
such as positively charged nitrocellulose or nylon membranes (see Sambrook et al. 

20 (1989) Molecular Cloning: a Laboratory Manual^ 2nd Ed., Cold Spring Harbor 

Laboratory) as well as porous glass wafers such as those disclosed by Beattie (WO 
95/1 1755). Nucleic acids are immobilized to the solid support by well established 
techniques, including charge interactions as well as attachment of derivatized nucleic 
acids to silicon dioxide surfaces such as glass which bears a terminal epoxide moiety. At 

25 least one species of nucleic acid molecule, or fragment of a nucleic acid molecule 

corresponding to the genes from stem cells whose expression levels are modulated during 
stem cell differentiation, proliferation, dedicated differentiation and survival may be 
inmiobilized to the solid support. A solid support comprising a representative grouping 
of nucleic acids can then be used in standard hybridization assays to detect the presence 



BNSDCXID: <WO 9910535A1_IA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/ 17283 



-32- 

or quantity of one or more specific nucleic acid species in a sample (such as a total 
cellular mRNA sample or cDNA prepared from said mRNA) which hybridize to the 
nucleic acids attached to the solid support. Any hybridization methods, reactions, 
conditions and/or detection means can be iised , such as those disclosed by Sambrook et 
5 al (1989) Molecular Cloning: a Laboratory Manual, 2nd Ed., Cold Spring Harbor 
Laboratory, Ausbel et al. (1987) Current Protocols in Molecular Biology, Greene 
PubHshing and Wiley-Interscience. N.Y. or Beattie in WO 95/1 1755, 

One of ordinary skill in the art may determine the optimal number of genes that 
must be represented by nucleic acid fragments immobilized on the solid support to 

10 effectively differentiate between samples that are at the various stages of stem cell 
differentiation, including terminal differentiation, proUferating stem cells, stem cells 
(dedicated to a given differentiation pathway and/or stem cells with increased survival 
rates. Preferably, at least about 5, 10, 20, 50, 100 , 150, 200, 300, 500, 1000 or more 
preferably, substantially all of the detectable mRNA species in a cell sample or 

15 population will be present in the gene expression profile or array affixed to a soUd 

support. More preferably, such profiles or arrays v/ill contain a sufficient representative 
number of mRNA species whose expression levels are modulated under the relevant 
differentiation process, disease, screening, treatment or other experimental conditions. In 
most instances, a sufficient representative number of such mRNA species will be about 1, 

20 2, 5, 10, 15, 20, 25, 30, 40, 50, 50-75 or 100 in number and will be represented by the 
nucleic acid molecules or fragments of nucleic acid molecules immobilized on the solid 
support. For example, nucleic acids encoding all or a fii^gment of one or more of the 
knovm genes or previously reported ESTs that are identified in Tables 2 and 3 may be so 
immobilized. Additionally, the skilled artisan may select nucleic acids encoding the 

25 protein cell surface markers discussed above at page 8 {i.e., CD 34) in order to help 
identify the particular stage of differentiation of a given stem cell population and to 
identify agents that are involved in promoting such differentiation. The skilled artisan 
will be able to optimize the number and particular nucleic acids for a given purpose, i.e., 
screening for modulating agents, identifying activated stem cells, etc. 



BNSDOCID: <WO 991053SA1JA> 



SUBSTTTUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/17283 



-33- 

In general, nucleic acid fragments comprising at least one of the sequences or part 
of one of the sequences of Table 2 can be used as probes to screen nucleic acid samples 
from cell populations in hybridization assays. Alternatively, nucleic acid fragments 
derived from the identified genes in Table 3 w^hich correspond to the sequences of Table 
5 2 may be employed as probes. To ensure specificity of a hybridization assay using probe 
derived from the sequences presented in Table 2 or the genes of Table 3, it is preferable 
to design probes which hybridize only with target nucleic acid under conditions of high 
stringency. Only highly complementary nucleic acid hybrids form under conditions of 
high stringency. Accordingly, the stringency of the assay conditions determines the 
10 amount of complementarity which should exist between two nucleic acid strands in order 
to form a hybrid. Stringency should be chosen to maximize the difference in stability 
between the probertarget hybrid and potential probe:non-target hybrids. , 

Probes may be designed from the sequences of Table 2 or the genes of Table 3 
through methods known in the art. For instance, the G+C content of the probe and the 
15 probe length can affect probe binding to its target sequence. Methods to optimize probe 
specificity are commonly available in Sambrook et al {Molecular Cloning: A Laboratory 
Approach, Cold Spring Harbor Press, NY, 1989) or Ausubel et al {Current Protocols in 
Molecular Biology, Greene Publishing Co,, NY, 1995), Any available format may be 
used in designing hybridization assays, including immobilizing the probes to a solid 
20 support or immobilizing the cellular test sample nucleic acids to a solid support. 

It should be xmderstood that the foregoing discussion and examples merely 
present a detailed description of certain preferred embodiments. It therefore should be 
apparent to those of ordinary skill in the art that various modifications and equivalents 
can be made without departing from the spirit and scope of the invention. All docimients, 
25 patents and references, including provisional patent application 60/056,861, referred to 
throughout this application are herein incorporated by reference. 



BNSDOCtO: <WO 9910535A1_IA> 



SUBSTltUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/17283 



-34- 

What is Claimed Is: 

1 . A method to identify an agent that modulates the expression of at least one 
stem ceil gene associated with the differentiation process of a stem cell population, 
comprising the steps of: 

5 preparing a first gene expression profile of an undifferentiated stem cell 

population; 

preparing a second gene expression profile of a stem cell population at a 
defined stage of differentiation; 

treating said undifferentiated stem cell population with the agent; 
10 preparing a third gene expression profile of the treated undifferentiated 

stem cell population; 

comparing the first, second and third gene expression profiles; and 
identifying an agent that modulates the expression of a least one gene in 
undifferentiated stem cells that is associated with stem cell differentiation. 

2. A method to identify an agent that modulates the expression of at least one 
stem cell gene associated with the proliferation of a stem cell population, comprising the 
steps of: 

preparing a first gene expression profile of a non-proliferating stem cell 

population; 

preparing a second gene expression profile of a proliferating stem cell 

population; 

treating the non-proliferating stem cell population with the agent; 
preparing a third gene expression profile of the treated stem cell 

population; 

comparing the first, second and third gene expression profiles; and 
identifying an agent that modulates the expression of a least one gene that 
is associated with stem cell proliferation. 



15 



20 



25 



BNSDOCID: <WO 9910535Al_IA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 PCT/US98/17283 



-35- 

3. A composition comprising a grouping of nucleic acid molecules that 
correspond to at least part of the sequences of Table 2 or genes of Table 3 affixed to a 
solid support. 



BNSDOCID: <WO 9910535A1_IA: 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



PCT/US98/17283 



1/2 



FIG. I 




SUBSTTTUTE SHEET (RULE 26) 



BNSCXDCID: <WO 991053SA1JA> 



wo 99/10535 



PCTAJS98/17283 



2/2 



FIG. KCont) 



Cla I pattern AC 



CC 



GC 



AG 



GG 



GG 



bp 
1000 



CO ^ 

+ rn x: CD 



^Sr DC CC ^ CC 

c i C S C CC CC CC c OC DC DC 
l_l I I I I I —J — I — \ I— I— I 



CO 5 
'^^f CC 

:n n: cQ + x cq 



CC 



520 - 

500 y. 



390 



340 rM: 



298 



200 




...... v;?^-:r-v' 




•••:-x-:-x5- 




ffcp^ ttSB^P :r:?::::>? '^ii^ig . 



:-;;:';-s5?2|5 



SUBSnrUTE sheet (rule 26) 



BNSDOCID: <WO 9910535A1_IA> 



wo 99/10535 



1 



PCT/US98/17283 



SEQUENCE LISTING 

<110> Yale University 

<120> A PROCESS TO STUDY CHANGES IN GENE EXPRESSION IN STEM 
CELLS 

<130> 44574-5014-WO 

<140> PCT/US98/i7283 
<141> 1998-08-21 

<160> 93 

<176> Patehtin Ver. 2.0 

<210> 1 
<211> 178 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<4 00> 1 

tttaattagc gctctatata cattgcggaa cttcccccga ctgcagcagt ttgactttgg 60 
cacaacatca agttccattt cttttggaca ttggattctg ttttganagt atgtatgccc 120 
caaagcattt tcagtgtcat caggattagt tgggcccatt cacagtaatt cananatc 178 

<210> 2 

<211> 148 

<212> DNA 

<213> murine 

<400> 2 

tagaacacct ggatggcttc tcttgtccac ccgatctccc gtgttaccaa tgtgtatggt 60 

ctccttctcc cgaaagtgta cttaatcttt gctttctttg cacaatgtct ttggttgcaa 120 
gtcataagcc tgaggcaaat aaaattcc 148 

<210> 3 
<211> 203 
<212> DNA 
<213> murine 

<400> 3 

gatctggcta gacagttatt ctgaactatg gcttcaagat gaacaagaca agcctaaaag 60 

gatggagaga ggcaatggag ataatgtttt ggaggaagta tgtcactcaa gcatgaactc 120 

tgtttattta gaaatgagat tccatatatg tggtacatgt ggaaagaatc taaaaagtcc ■ 180 

tttaaatttt ttcattccaa aag 203 

<210> 4 

<211> 336 

<212> DNA 

<213> murine 

<220> 

<221> variation 

<222> (various) ' 



BNSDOCID:<WO 991053SA1 tA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 PCT/US98/17283 



<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 4 

ct.nnannagc 

tgtncacgtn 

ctgtnntgta 

aacatnctca 

tcctctcagg 

tgtagnttat 



actcttcttg 
acnnacttna 
ttcccctcta 
aagcctntga 
ggtttctncc 
ctttnaataa 



gccagacctc 
tcnaaactnt 
gacaaaggan 
tggaggagca 
caccnaggca 
atttnaataa 



tgtccaaggc 
tgctgtnttg 
caacnnaaaa 
caaggaccct 
gtgccttcat 
aancta 



tcattagaaa 
gcataagttg 
gtnnttgcnn 
gtctgctgag 
tngctagtng 



gctggggttn *60 
tgtntctgga 120 
nctttnccag 180 
ggcccatggn 240 
tncagttact 300 
336 



<210> 5 • 
<211> 113 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 5 

ctagattgtg tggtttgcct cattgtgcta tttgcgcact ttccttccct gaagaaatan 60 
ctgtgaanct tctttctgtt cagtcctaan attcnaaata nagtgagact atg 113 

<210> 6 
<211> 164 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 6 

ctcaagnacg ggccaggtaa gggcctttaa cacaactaaa tcaaggtgtg. cttncctccg 60 

ggttctatgc aagcaaggca tacacactgc actctcncnc tchctaaact ggaaangtac 120 

agtngcaggg ctggtttcag acn$cgtgat gcntgtttac aaac 

<210> 7 
<211> 141 
<212> DNA 
<213> murine 



<400> 7 

tttttattca atatattaaa tatattaatc agaaaagtca catcctataa atccaggaaa 60 
atacacaaat ataaatcaga atctgtcaat caccttcttg agtgacagtt atgtacacat 120 



ggaaggagag cggaagagat c 

<210> 8 
<211> 224 
<212> DNA 
<213> murine 



14.1 



<400> 8 

cgatatacac catcggtctg gggccaacgc 
tggtttgctg tgaatctcta tcaacaagag 
aaagaacaag aagatgatgg atacattgat 



taatactact tggtgctgcc aattgaattc 60 
tatcatttgt gaatgcttta atttattgag 120 
acatttgcgc agccttgcag cctgactcaa 180 



BNSDOCID: <WO 9910535A1JA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



3 



PCT/US98/17283 



ttctgctgtt catcagtttt aatgtccttt ctgtgtcata cgtg 



21^ 



<210> 9 
<211> 210 
<2i2> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G . 

<400> 9 

gatctttttt ccttcactta ttgctgaaac caagngcaca attcccatta agngaaggat 60 

ctctgtgctg taaactaaac aaattgtgca ttttttctgg ggccattgtt tttggtttat 120 

tttgttattt tgttttgttt ttgttttttt ggtttcattt tgttttgggt tggtccaatt 180 
ttaaaaggaa atactacaat aaaaatgtta 210 

<210> 10 
<211> 163 
<212> DNA 
<213> murine 

<400> 10 

gatctgattt gctagttctt cctggtagag ttataaatgg aaagattaca ctatctgatt 60 

aatagtttct tcatactctg catataattt gtggctgcag aatattgtaa tttgttgcac 120 
actatg.taac. aaaactgaag atatgtttaa taaatattgt act 163 

<210> 11 
<211> 176 
<212> DNA 
<213> murine 

<400> 11 

gcgatgttct tctactcaca actcacgttg gtggcctggg cctgaacttg actggagctg 60 

acactgtggt gtttgtggag catgactgga accctatgcg agatctgcag gccatggacc 120 

gggcccatcg tattgggcag aaacgtgtgg ttaatgtcta ccggttgata accaga 176 

<210> 12 

<211> 123 

<212> DNA 

<213> murine 

<4 00> 12 

gatctggaag ggaatgtcca aagagaagaa ggaggagtgg gaccgcaagg ctgaggatgc 60 

taggagggag tatgagaaag ccatgaaaga gtatgaagga ggaagagggg actcatctaa 120 
aag 123 

<210> 13 
<211> 196 
<212> DNA 
<213> murine 

<400> 13 

gatcttcgac acagagaagg agaaatacga gattacagag cagcgaaagg ctgaccagaa 60 

agctgtggat ttgcagattt tgccaaagat taaagccgtt cctcagctcc agggctacct 120 

gcgctctcag ttttccctga caaacgggat gtatcctcac aaactggtct tctaaattgt 180 
taacctaatt aaacag 196 



<210> 14 



SUBSTITUTE SHEET (RULE 25) 

BNSDOCID: <WO 991053SA1JA> 



wo 99/10535 



4 



PCT/US98/17283 



<211> 225 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<'222> (various) . 

<223> bases designated as "n" at various positions 
tnroughout the sequence may be A, T, C or G 

<400> 14 ^ 

actcaatccc ttcaaactct ttatactggn ctatnatnag nggggatgtg ncaanatnga 60 

cnczggzqqt gtatgaaaga aaagntcnat ggacntnggc atnccaagat tgaattcacp 120 

tgcttcctac gatgtgtgaa actgctaata gcaaaatatc tctanggtta tgangagtac 180 
tgtcgttctg caaatattca cttcanaact anncaccacg ttnaa 225 

<210> 15 
<211> 244 
<212> DNA 
<213> murine 

<220> 

'^<221> variation 

<222> (various) - 
<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C . or G 

<400> 15 an 
ctagataatc ccttactgag tctttcttcn caggtgattc anttgagttg acaattannn t»u 
ctaagaattc aatggactan tgaggtgcct cagcagntaa tagcanttgc tgttcttcca 120 
gaggaccaga gttcagtttc tcatcccaag ttgggctgct cgtnagtgtc ggtaantcca 180 
gcttcagggg cttgaattta tactgaccat gggcacctgt accccaacac anacacatac 240 
acat 

<210> 16 
<211> 233 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 16 - ^ 

ctaaaagtta atcctgtnaa gcatggtaag aatancattc tcaanatctt gagttaanaa bu 

agatcttgga ggnggctggn gagatggctc antggttaag ancnctgact gctcttccag 120 

aggtcctgan ttcaattccc ancaaccaca tggtggntca caaccanctg taatgatacc 180 



tgatgccatc ntccgtggtg tatctgaana canctacagt gacagctaca ncg 

<210> 17 
<211> 260 
<212> DNA 
<213> murine 

<400> 17 

ggattttatt ctaggcttgg ccagatacag gttggcatcc taggggagga agataacaat 

gtcataggtg aatttgttag gagaggcaag acatgggaaa tcattgattt cttcagattt 120 

ctttaaagca aattagaaga taaatgtcta aaagagatac acttaaaaaa tggtgaaact 180 

ataaccccct aaggagagcc agatgtggca ggagccaggt czgaaaatgg tagctgaagt 240 



60 



SUBSTITUTE SHEET (RULE 25) 

BNSOOCID: <WO 9910&3SA1JA> 



wo 99/10535 



5 



PCT/US98/17283 



aagcagacca gcgtaagatc 260 

<210> 18 
<211> 154 
<212> DNA 
<213> murine 



<400> 18 

cgatgagtca gagaggaagt ggacagtgcg ttattcatta cagcaaagga tttcgttggc 60 
atcaaaatct aagtttgttt tacaaagatt gtttttagta ctaagctgcc ttggcagttt 120 
gcatttttga gccaaacaaa aatatattat tttc 154 

<210> 19 
<211> 340 
<212> DNA 
<213> murine 

<400> 19 

cgattcaatt gtataaatga ttataatttc tttcatggaa gcatgatcct tctgattaag 60 
aactgtaccc catattttat gctggttgtc tgcaagcttg tgcgatgatg. ttatgttcat 120 
gttaatccta tttgtaaaat gaagtgttcc tgaccttatg ttaaaaagag agaagtaaat 180 
aacagacatt attcagttat tttgtccttt atcgaaaaac cagatttcat ttttcctttt 240 
tgtttgtgat ctcatttgga aataattggc aagttgaggt actttcttcc catgctttgt 300 
acaatataaa ctgttatgcc tttcagtgcg ttactgtggg 340 



<210> 20 
<211> 277 
<212> DNA 
<213> murine 

<400> 20 - 

ctagaggtgg gaactggctc cactccacac agcagccagt tagttagtga cggtcagctg 60 
catgcagggg aatgaaggac tcggagagaa cgttctgtgc tatgtgtgtt ccatagagat 120 
taaaaaggag gcctggagcc gagcatggtg gtgcacgcct ttaatcccag cacttgggag 180 
gcagagtcag gtggatttct gagttcattg ccagcctggt ctacagagtg aattccagga 240 
caggcagggc tacacagaga aaccctgtct caaaaaa 277 

<210> 21 ■ • - , 

<211> 66 
<212> DNA • 
<213> murine 



<400> 21 

ctagaatttg cagtagcatt aattcaagcc tacgtattca ccctcctagt aagcctatat 60 
ctacat 66 



<2I0> 22 
<211> 121 

<212> DNA : , - . 

<213> murine 

<220> / 
<221>- variation ' 

<222> (various) - 
<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 22 

ctagacataa gatattgtac ataaaganaa ttttttttgc ctttaaatag ataaaagtat 60 
ctatcagata aaaatcangt tgtaagttat attgaagaca atttgataca taataaaaga 120 
t .121 



BNSOCXIO: <WO_991053SA1_IA> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



6 



PCTAJS98/17283 



<210> 23 
<211> 127 
<212> DNA 
<213> murine 

<220> 

<221> variation 

<222> (various) . . 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 23 



ggggagnnnn cnagnaanna gantcgtacg taaanagaan nntggtgcnt "anatagaa 60 
aingtactat canataanaa tcaggttgta agttatattg aagacgnttt gatacataat 120 
aaaagat 

<210> 24 
<211> 105 
<212> DNA 
<213> murine 

cJagactgac aaagactttt tgtcaacttg tacaatctga agcaatgtct ggcccacaga 60 
cagctgagct gtaaacaaat gtcacatgga aataaatact ttatc 

<210> 25 
<211> 85 
<212> DNA 
<213> murine 

cJc^cttgcc acccagatgg. ttaggatgat tctgaagatg atgacatccg taagcctgga 60 
gaatctgaag aataaactgt accat 

<210> 26 
<211> 85 

<212> DNA , . . . 

<213> murine 

cJcScttgcc acccagatgg ttaggatgat tctgaagatg atgacatccg taagcctgga .60 
gaatctgaag aataaactgt accat 

<210> 27 
<211> 316 
<212> DNA 
<213> murine 

gatctcggaa tggacccaac tgctcctgct ccaccggcgg ctcctgcact tgcaccagct 60 
cctgcgcctg caagaactgc aagtgcacct cctgcaagaa gagctgctgc tcctgctgtc IZU 
ccgtgggctg ctccaaatgt gcccagggct gtgtctgcaa aggcgccgcg gacaagtgca 180 
cgtgctgtgc ctgatgtgac gaacagcgct gccaccacgt gtaaatagta tcggaccaac 
ccagcgtctt cctatacagt tccaccctgt ttactaaacc cccgttttct accgagtacg 300 
tgaataataa aagcct 

<210> 28 
<211> 136 ' 
<212> DNA 
<213> murine 



SUBSTTTUTE SHEET (RULE 26) 



BNSDOCID; <WO 99l0535A1_tA> 



wo 99/10535 



7 



PCT/US98/17283 



<400> 28 

attcagacga atgagactcc tccacattgg agacaagaga tgcagagagc tcagagaatg 60 

agggtgtcaa gtggtgaaag atggatcaaa ggggataaga gtgagttaaa tgaaataaaa 120 
gaaaatcaaa ggagcc I35 

<210> 29 
<211> 243 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 29 

ngcnnnnnnn ccagnaggag gagaagatga ctggccagta tcanaatggg ataagatgag 60 

gcgcgccctg gagtacacca tctacaacca ggagctcaac gagacgcgcg ctaagctcga 120 

cgagctttct gctaancgag aaacnagtgg agagaaatcc ngacaactaa gggatgccca 180 

gcaggatgca ngagacaaaa tggaggatat tgagcgccag grtagagaac tgaaaacaat 240 
nat 243 

<210> 30 
<211> 359 
<212> DNA 
■<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 



<400> 30 

ctcaaggaaa 

cnnntngncc 

gtgggaaagr 

atcggttgtt 

tctttaattt 

tctactgttc 



agacagcacc 
tggcaacggt 
ccgagcctta 
agttgccttg 
atgtaaggtt 
aatgagaaca 



ncgtgcctgg 
tcctgaacna 
ngacccagtt 
agttgggaac 
ttntgtnctc 
ttaggcccca 



catctgntgn 
attaccactc 
tcagttctgg 
gtttgcatcg 
aattctttaa 
gcaacacgtc 



nttagntnat 
cttcttgcca 
tttcttccct 
acacctgtaa 
gaaatgacaa 
attgtgtaaa 



ntnnaantnt 60 
gtcnaanagg 120 
cctgancacc 180 
atgtattcat 240 
attttggttt 300 
naaataaaa 359 



<210> 31 
<211> 139 
<212> DNA 
<213> murine 

<400> 31 

cgatggctcc atcctggcct cactgtccac cttccagcag atcggctcag caagcaggag 60 
taggatgagt ctggcccctc catcgtgcac cgcaaatgct tctaggcgga ctgttt taca ' 120 
ccctttcttt gacaaaacc 139 

<210> 32 
<211> 354 
<212> DNA 
<213> murine 



<220> 

<221> variation 
<222> (various) 



SUBSTITUTE SHEET (RULE 26) 

BNSDOCIO:<WO 9910535A1_IA> 



wo 99/10535 



8 



PCT/US98/I7283 



<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 32 

cnnatgctac 

ccggancaaa 

tcnagaannt 

gatggaaann 

tgctccccaa 

acaccctgtt 



atgctgnagg 
ttgcttccag 
cttttattta 
cgcatcccct 
acncaaancc 
tancccccna 



atgcctaagg 
atgtgacttt 
aaggaggaaa 
ttctagccag 
cacttcngan 
ctctctgctt 



ctgcccccca 
ggaaccttcn 
nannacatcc 
ctgttcccaa 
cctccaccta 
atacccngga 



ccatcccctg 
cacccctnac 
aagaaaangg 
aaggtaccct 
aancatcang 
acaattnntg 



gctctgctgn 60 
ccnaccnntc 120 
ggggaggggg 180 
tcctctctgc 240 
caagtcacnt 300 
ctcg 354 



<210> 33 . 
<211> 412 
<212> DNA 

<213> murine - 
<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 33 

cgatggtggg 

atgacaaaat 

aatgtccctt 

tttttgcccc 

ggaagctgcc 

tggttccaaa 

aggcgtcact 



gatcttactg 
ggaagccaag 
tatcagaggg 
cctgtctgat 
acacacaang 
tctgaanaaa 
ctgccagagt 



gggaagagga 
acaccttgaa 
aaggggacaa 
gttgatgagg 
actctggaag 
aggtttttca 
gtgacttttt 



aggaccatta 
ggtgactttc 
actcagggca 
ggtcatacca 
tatccagatg 
cacactcctt 
acagattaaa 



gcacaccatc 
taggaaggtc 
gccctgtcca 
nccagggaga 
tgagcccagc 
gctttctgct 
taaagctgtt 



atgatgtcag 60 
ttaagcatgt 120 
ggtagaaata 180 
ccctctggga 240 
cagggtccta 300 
aagataanaa 360 
at . . . 412 



<210> 34 . 
<211> 239 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 34 

gatctactcc attcccctgg aaatcatgca gggcaccggg ggtgagctgt ttgatcacat 60 

tgtctcctgc atctccgact tcctggacta catggggatc aaaggccccg gatgcctctg 120 

ggcttcacct tctcgtttcc ctgcaagcag acgagcctat attgcggaat cttgatcacg 180 

tggacaaagg gattcaaagc caccgactgt gtgggtcacn atgtanccac tttactgag 239 



<210> 35 
<211> 93 
<212> DNA 
<213> murine 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 

.<400> 35 

gatcrgagtt cgaggccagc ctggrctaca gagtgagttc caggncagcc aggncracac 60 



SUBSTITUTE SHEET (RULE 26) 

BNSDOCID: <WO ©910535A1JA> 



wo 99/10535 



9 



PCT/US98/I7283 



agagaaaccc tgtctcgaaa aaacagaaag aga 93 

<210> 36 
<211> 130 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 36 

ctttcattaa . aaagaaacca ggggctggan agatggctca gtggttaaga gcaccaactg 60 

ctcttcccga aggtcctaag ttcaaatccc agcaaccaca tggtggctaa caaccactcg 120 
taatgagatc 130 

<210> 37 
<211> 234 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 37 

atcgcntggc tctcctgngg cctggcntac gacnngaaaa ggagtgtcca cggctgctgt 60 

cgnggccacg attaattaaa actgaagtac cgaggntncc ccagngncng antgtggggt 120 

cnngccnttc ntgntccaca anccaacttg gcagacgctt actgtnctgt caactntcnn 180 

nngaataccn ccacccncat gctaaaatga tgactgacgt taanccatgc tggt 234 

<210> 38 
<211> 251 
<212> DNA 
<213> murine 

<400> 38 

cgatgacaaa ggagtcctga ggcagattac tctgaatgac cttcctgtcg gaagatcagt 60 

ggacgagaca ctgcgtttgg ttcaagcctt ccagtacact gacaagcatg gagaagtctg 120 

ccctgctggc tggaaacctg gtagtgaaac aataatccca gatccagctg gaaaactgaa 180 

gtatttcgac aagctaaact gaaaagtact tcagttatga tgtttggacc ttctcaataa 240 
aggtcattgt g 251 

<210> 39 
<211> 179 
<212> DNA 
<213> murine 



<220> * . . - . 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 39 

cgatgctgaa taagcrcctc aaaaagtggt aaatttaacc trttnaaaaa acaagctttc 60 
tctgtacagc tctggctgtt ttgttctgga atacattctg tagaattgtc tggcctctaa 120 



SUBSTITUTE SHEET (RULE 26) 

BNSDOCID: <WO 9910535AlJA> 



wo 99/10535 



10 



PCT/US98/17283 



cttggagatc caactccctc tgcctcttga gtgctgggat taatggcatg tgacactgt 179 

<210> 40 
<211> 21'9 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 40 

cgatgacctc atgccggccc agaagtgaag cctggccctc gccaccatca ggctgccgct 60 

tcctaactta ttaaccgggc agtgcccgcc atgcatcctt gangtttgcc gcctggcggc 120 

tgagccctta gcctcgctgt agagacttct gtcgccctgg gtagagttta tttttttgat 180 

ggntaanctg ttgctgacac tgaaaataan ctagggttt 219 



<210> 41 
<211> 303 
<212> DNA 
<213> murine 



60 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 41 

cgatcaatga aaagatgacg agtttctttc aaatgggcag ttactccctg ataacttcat 
agctgcctgc acagagaaga aaatccctgt tgtgtttaga ctacaagagg gttatgatca 120 
tagctactac ttcattgcaa ctttcatcgc tgaccacatc agacaccatg . ctaagtacct 180 
gaatgcatga naagcctcag ccaagagaat ctcatcagga ggccggaagg gaatcaacag 240 
gagtgctgac ttcctcgcag aagatcatgc tcctgcagct gaatcgcttt tctgaataaa 300 
tat 

<210> 42 
<211> 460 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as *'n" at various positions 
throughout the sequence may be A, T, C or G 



60 



<400> 42 

cgatgtntac ttcattgcca ccctgtcant cctctggaag gtgtccgtca tcaccttggt 
cagctgrctc cccctctatg tcctcaagta cctgcggaga cggttctccc cacccagcta 120 
ctcgaagctc acttcctaag ctgcagggct gcctcgggca gggcctccgg cctccggcgc 180 
tctcccagga ggaggtcaag ttccacacgc acgagccgcc tctgctggac ggtgcagtca 240 
tggctggcac atgaggcttc gctgaggcga cactgggcac ctaatgggga tggaacattg 300 
gtggaaccgg agggagggac ctgagagctg tacctatcag aaccttgggt gctaagctgt 360 
gctgaggggg aagacgtggg accggatggc ccgtctgagg tttgtggggt cactgtgcaa 420 
gcttccttat ggtttgaacc tcttgtcatg tgataaaagt 

<210> 43 
<211> 120 



4 60 



BNSDOCID: <WO 9910535A1 JA> 



SUBSTrrUTE SHEET (RULE 26) 



wo 99/10535 



11 



PCT/US98/17283 



<212> DNA 
<213> murine 

<400> 43 

cgatttacgt atttgactga aatgaaagtt ccactaaacg gtatttgctc ttgtgatatg '60 
tggcacattg tgatattttc ttagtctgrt ctgtttcatt taaaaaataa aactgctgat 120 



<210> 44 
<211> 132 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 44 

ccgatgtncg ataatagtaa ataccttaat tanttaaata attcattgna ttgtttcaga 60 

gacatttgga aattacrgta tacatttaca acctaatgac ttttgtattt tatttttcaa 120 
aanaaaagct ta 132 

<210> 45 
<211> 240 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 

<46o> 45 

cnttngnnnn tccntncatc ncngcngtnt gagtcccncc caannagtcc atccaananc 60 

canngcatnn cagctttatc atgacaacaa antggagnaa gaagaagatg agtttcggcc 120 

actgtugagg caaatcnntg nnnantcnta atanacacct ggtccgctca tccttcaacg 180 

ttgttnrnta naantcacct cccagtagaa angctagcaa ntttnacctg ccacnggttn 240 

<210> 46 ' : 

<211> 126 ■ 
<212> DNA 
<213> murine 



<220> 

<221> variation -..^ 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 46 

cgatcagatg tcacgcggga cacancnccg ccncagtnaa tggnaatata tttgcatgtt 60 

accccaaatt ancttctntg catngaacat . angtangtgt ctttggggac acgtgtgttc 120 

tactac 126 

<210> 47 
<211> 383 
<212> DNA 
<213> murine 



BNSDOCID: <WO 9910535A1_1A> 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 PCT/US98/17283 

12 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 47 

cqatttacaa atgaacaanc aagattacat atantgaaaa tccacgcagg acctattaca bO 

nagcatagtg aaatagatta tgaagcaatt gtaaagcttt cagatggctt taatggagca 120 

tgacctgaca aatgtttgta ctgaagcagg tatgtttgca attcgtgccg atcatgattt 180 

tgtanttcag gaagacttca tgaaagcagt cangaangtg gctgactcca agaagctgga Z40 

qtccaagctg gactacaaac ctgtgtgatt cactannagg gtttggtggc tgcatgacag 300 

acattggttt aatgtanact taacngttan ngaaactaat gtanntattg gcaatganct 360 
tattanaagt gaatanacat gtg 

<210> 48 
<211> 255 
<212> DNA 
<213> murine 

<400> 48 £in 
cgatattttt aattaagaag aaattcactt tctcattacc tatgaatctg tgccagggca- 60 
ggtgattttt gagtatgaga actttgtcct ctccacagtt gtcacaaaaa tggttccttc . 120 
tcattgaact attgtggcat gctaattaag aagtgagtga ccacttggga ggcagaggca 180 
ggtggatttc tgagtttgag gccagcctgg tctacaaagt gagttctaag acagccaggg 240 
ctatacagag aaacc 

<210> 49 
<211> 243 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 

throughout the sequence may be A, T, C or G ' 

<400> 49 

ccaagnaata tggtctaatc aaaggtcgtc tgtctgcttt tgattgtcta catcacagca 60 
atccctggga atttctatcc attttaaatg cngccgcttt catctgttta gccagcacac 120 
ccaatggttt cactaactag cccagttgac cttttggaag- tttgagcctt gagcaccttc 18U 
aacaaaattg agcactctga ttaggatatc cactttgcaa ataaaaccaa atgttttgtc 240 
aac 

<210> 50 
<211> 358 
<212> DNA 
<213> murine 

<220> : 
<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 

.<400> 50 

cgatgagggg aagatgacct gggccgggga ggccatccct tatccaagat cacagggaat bu 
tctgggaaga ggttggcctg tggcatcatt gcacgctctg ccggcctttt ccagaacccc 120 
aagcaaatct gctcctgtga tggcctcact atctgggagg agcgaggccg gcccattgcc 180 
ggtcaaggcc gaaaggactc agcccaaccc ccagctcacc tctaaacaga gcctcatgtc 240 



SUBSTTTUTE SHEET (RULE 26) 

BNSDOCID: <WO 9910535A1JA> 



wo 99/10535 



13 



PCT/US98/I7283 



aggttatttg gtcctcgtag ctgaacatct tcttgcagag ggagctgcng gcccttgctt 300 
gtacaggcct aagtacaggg cagaraagtg ctgtagcctg aacaaattaa attgttac 358 

<210> 51 
<211> 355 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 51 

cgattagctg 

agtagctctg 

gcccattacc 

cgtactgttc 

tgcgtagtgc 

tgcgcagaga 



nggtctctag 
aancaggtga 
agccagctaa 
aacctcccgg 
gtcagcaatg 
ggtgcgcaga 



ganatactcg 
agaatcctcc 
ttggtcaaga 
cagtcggttt 
cgcagagggg 
gaggcagtgc 



tcactatatg 
tctgaggaaa 
aaaaagccaa 
caaggtccgc 
caatgcgcag 
gcagagaggc 



agctcaggan 
cagactggga 
aagcngctgg 
cctatgcgga 
agaggtgcgc 
agtgcgcaga 



gccagctctt 60 
ggaagaagca 120 
cgaaagtcag 180 
gcccccgccc 240 
agaggggcag 300 
ctcat 355 



<210> 52 
<211> 213 
<212> DNA 
<213> murine 

<400> 52 

cgatttctaa atcagtctcg cctgtgctag gatgaccggt aatgagcctg tttaaaataa 60 

gacttaaaag tgtcgtgcgt tggccgggcg gtaggggcgc atgcctttaa tttcataact 120 

tggaggtaga gacaggcgga tctttgtgag ttcaaggtca gcctggtgta cagagtgact 180 

tccagaacag ccagggctgt taaacagaga aac 213 

<210> 53 

<211> 113 ^ 
<212> DNA 
<213> murine 

<220> , 
<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 53 

ttgttttgtt nttcagatag ggtcttacat atcccatgct ggtctcaaac tcacattatg 60 
catgcgggga aagccattta ctgactgata tacccctggc cctaagatag ate 113 

<210> 54 
<211> 108 
<212> DNA 
<213> murine 



<400> 54 

cgatcgrcgt tctggtaaga agctggaaga tggccccaag ttcctgaagt ctggccattt 60 
aagtttaata gtaaaagact ggttaatgat aacaatgcat cgtaaaac 108 

<210> 55 
<211> 257 
<212> DNA 
<213> murine 



. SUBSTITUTE SHEET (RULE 26) 

BNSOOCJD: <WO 9910535A1JA> 



wo 99/10535 



14 



PCT/US98/17283 



120 
180 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 55 

cqatcgtcgt tctgagtaan aagctggaan anggccccaa gttcctgnng tctggcgatg 60 

ctgccattta agttnannag ananaagact ggctnatgat aacaatgcan cntaaaacct 

tcaggnaggn aacgaatgtt gtggaccatt ttttntgngt gtggcagttt naagttatna 

agntttcaaa ancantactt nttaanggga acaacttgac ccatcanctg tcacagaatn 24 0 
ttgangacca ttaacac 

<210> 56 
<211> 151 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 56 ^ ^ cn 

nctacgatca tctagatcta ctagacctac nacnagacca tgggccaaan atggtcgacc 60 

tgcaaacttg caaggtttat tttanataca cattatggcg ttttatnttt tgtaattcta 120 

agttgtaatt cagcttttaa caaatctttt t 

<210> 57 
<211> 152 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 

<400> 57 

ccaagnanat cnagactact agacctacta cnagaccatn ggncaaacat ggtcgaccnn ou 
caaacgnata ngtatatttn anatacacan anatagcgtt ntatgtctng taattctaag 120 
tngtanatca nctattanca aaatctttnt tt 

<210> 58 
<211> 188 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 

<400> 58 

cgatggaagt tctgctgagc ccttctgacg taaccctggc natggctaac actgtccttc t)U 
ctgcaacgtt cntggtggac acancttctc tggananacc ctgaangtgg cacgccctgt 120 
tccagcccac ctggtgtgca ctttttgccc tctttacctc attantaaat gttttcncgc 180 



SUBSTITUTE SHEET (RULE 26) 

BNSDOCIO: <WO 9910S35A1JA> 



wo 99/10535 



15 



PCTAJS98/17283 



tcctaatg 



188 



<210> 59 
<211> 136 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 59 

ctnagnaagg anctgtactt cgtattgcaa ggcagtctct tgtgtcttct tagagtgtct 60 
tccccatgca cagcctcagt ttggagcact agtttataat gtttattaca atttttaata 120 
aattgantag gtagta 136 

<210> 60 
<211> 365 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, C or G 



<400> 60 

tcntcnttct 

attgttgata 

cttggtcgct 

gtggacaaaa 

gctaaatgaa 

gtctcagaac 

ataac 



ggtaagaact 
tggtccctgg 
ttgctgttcg 
angctgctgg 
tattacccct 
tgttngtctc 



ggaatatggc 
caancccatg 
tgacatgagg 
agctggcnaa 
aacanctgcc 
aantggccat 



cccaagttcc 
tgtgttgaga 
cagacagttg 
gtcaccaagt. 
accncantct 
ttaagtttaa 



tgaagtctgg 
gcttctctga 
ctgtgggtgt 
ctgcccanaa 
taatcagtgg 
tantaaaaga 



cgatgctgcc 60 
ctaccctcca 120 
catcaaagct 180 
agctcagaag 240 
tggaagaacg 300 
ctggttaatg 360 
365 



<210> 61 
<211> 357 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 61 

cgatcntcgt 

ngccantgtt 

tccanttggt 

anctgtggac 

gaatgctaaa 

aacngtctca 



tctggtaaga 

gatatggtcc 

cgctttgctg 

aananggctg* 

tnaatattac 

gaactgtttg 



nncnggaaca 
ctggcaagcc 
ttcgtgacat 
ctggagctgg 
ccctaanacc 
tcncaattgg 



tggccccaag 
catgtgtntt 
gaggcagaca 
caagntcacc 
tgccacccca 
ccanttangt 



ttccngannt 
gagagcttca 
gttgctgtgg 
aantctgccc 
gtcntaatca 
ttaatnatac 



ctggcgangc; 60 
cnnacnaccc 120 
gtgtcancaa 180 
agaaagctca 240 
gtggtggaa;: 300 
aagactg 357 



<210> 62 
<211> 305 
<212> DNA 
<213> murine 



SUBSTITUTE SHEET (RULE 26) 

BNSCXXJtD: <WO 991053SA1JA> 



wo 99/10535 



16 



PCT/US98/17283 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 62 

gnnnnnnnnn 

ctgaaatcca 

agcggcccag 

ccatcaaaac 

aaatggccaa 

cccca 



nncnangaaa 
tcgccttccc 
ctcattctga 
tgtgtacttc 
gctggacgcc 



aagaggtgaa 
atccattggc 
agtgccatct 
atgctttttg 
aactaggcca 



aaatgcttgg 
agcggcagga 
ccagctacnt 
acagtgagag 
gtgatcccta 



ctctagctga 
acgggttccc 
tgtctccacg 
cataggtatc 
gagccagcac 



tgacagaaag 60 
ggaagcagac 120 
atgtcctcct 180 
tatgtgcagg 240 
atgcg^tgtc 300, 
305 



<210> €3 
<211> 327 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 63 

ctnangaaag 

tttatttcgg 

ggtgggcggg 

aaataaatgc 

aggtggggta 

gggaatgaat 



ctgctggggc 
aattacaaga 
acacggctct 
attcagaggt 
agtgcctcca 
cattggagta 



nccctgacat 
tatcgggaat 
taacatttnc 
ttntggggtc 
ggaaggcagg 
ataaact 



cactcatcac 
ctctctgcag 
agagggaaac 
catggccaag 
cagcctgcct 



tcactatgct 
gctggactgg 
gcgcanatgt 
tggagttccc 
tanacttgca 



accaattcta 60 
caggctgtgg 120 
ccaaaagtct 180 
ccncaggggg 240 
ncccggntgt 300 
327 



<210> 64 
<211> 271 
<212> DNA 
<213> murine 



<400> 64 

cgatgccaat 

ctgcaaccct 

tggtggcttc 

tgaagaggtg 

aacaagtaac 



ggcatcctca atgtttctgc tgtagataag agcacaggaa aggagaaagt 60 

atcattacca agctgtacca gagtgcaggt ggcatgcctg ggggaatgcc 120 

ccaggtggag gagctccccc atctggtggt gcttcttcag gccccaccat 180 

gattaagtca gtccaagaag aaggtgtagc tttgttccac agggacccaa 240 

atggaataat aaaactattt a 211 



<210> 65 
<211> 310 
<212> DNA 
<213> murine 



<400> 65 . 

cgatgaagat gaggtcactg cagaggagcc cagtgctgct gttcctgatg agatcccccc 6U 

tctggaaggc gatgaggatg cctcgcgcat ggaagaggtg gattaaagcc tcctggaaga 120 

agccctgccc tctgtatagt atccccgtgg ctcccccagc agccctgacc cacctggatc 180 

tctgctcatg tctacaagaa . tcttctatcc tgtcctgtgc cttaaggcag gaagatcccc 240 

tcccacagaa tagcagggtt gggtgttatg tattgtggtt tttttgtttg ttttattttg 



ttctaaaatt 



300 
310 



<210> 66 
<211> 579 



SUBSTrrUTE SHEET (RULE 26) 

BNSDOCID: <WO 99l0535AlJA> 



wo 99/10535 



17 



PCT/US98/I7283 



<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 



<400> 66 

cgatgccaat 

gatcaccatc 

agaagctgag 

ctcactggag 

caagatcaat 

gctggataag 

gaaagtctgc 

aatgcctggt 

caccattgaa 

anccaaaaaa 



ggcatcctca 
accaatgaca 
aagtacaagg 
tcctatgcct 
gatgaggaca 
aaccagactg 
aaccctatca 
ggcttcccag 
naggtggntt 
gtaanatgga 



atgtttctgc 
agggccgctt 
ctgaggatga 
tcaacatgaa 
aacagaagat 
cagagaagga 
ttaccaagct 
gtggaggagc 
aagtnatcca 
taataaaacc 



tgtagataag 
gagtaaggaa 
gaagcagaga 
agcaactgtg 
tcttgacaag 
agaatttgag 
gtaccagagt 
tcccccatct 
nnaagaaagg 
tatttaatt 



agcacaggaa 
gatattgagc 
gataaggttt 
gaagatgaga 
tgcaatgaaa 
catcagcaga 
gcaggtggca 
ggtggtgctt 
ntnccttttt 



aggagaacaa 60 
gcatggtcca 120 
cctccaagaa 180 
aacttcaagg 240 
tcatcagctg 300 
aagaactgga 360 
tgcctggggg 420 
cttcaggccc 480 
ttccaaaggg 540 
579 



<210> 67 
<211> 186 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 67 . 

cgatgccaat agnancccaa ntntctgcng tngataagac acangaaaag agaacaagat 60 

caccatcacc aatgacaagg gccgcttgag taaggaagat attgagcgca tggtccaaga 120 

tcaatgatga ggacaaacag aagattcttg acaagtgcaa tgaaatcatc agctggctgg 180 
ataaga 186 

<210'> 68 
<211> 321 
<212> DNA 
<213> murine 



<400> 68 

cgattagcgg 

agtagctctg 

gcccattacc 

cgtactgttc 

tgcgtagtgc 

cagtgcgcag 



aggtctctag 
aagcaagtga 
agccagctaa 
aacctcccgg 
gtcagcaatg 
actcattcat 



gagatactcg 
agaatcctcc 
ttggtcaaga 
cagtcggttt 
cgcagagggg 
t 



tcactagatg 
tctgaggaaa 
aaaaagccaa 
caaggtccgc 
caatgcgcag 



agctcaggaa 
cagactggga 
aagcggctgg 
cctatgcgga 
agaggcagtg 



gccagctctt 60 
ggaagaagca 120 
cgaaagtcag 180 
gcccccgccc 240 
cgcagagagg 300 
321 



<210> 69 
<211> 321 
.<212> DNA 
<213> murine 



<400> 69 

cgattagcgg aggtctctag gagatactcg tcactagatg agctcaggaa gccagctctt 60 
agtagctctg aagcaagtga agaatcctcc tctgaggaaa cagactggga ggaagaagca 120 
gcccattacc agccagctaa ttggtcaaga aaaaagccaa aagcggctgg cgaaagtcag 180 
cgtactgttc aacctcccgg cagtcggttt caaggtccgc cctatgcgga gcccccgccc 240 



SUBSTmjTE SHEET (RULE 26) 

BNSDOCID: <WO 99l0535A1„IA> 



wo 99/10535 



18 



PCT/US98/17283 



tgcgtagtgc gtcagcaatg cgcagagggg caatgcgcag agaggcagtg cgcagagagg 300 
cagtgcgcag actcattcat t 321 

<210> 70 
<211> 495 
<212> DNA 
<213> murine 



<400> 70 

gatctttgta 

gtaccctgat 

aataactgac 

cttgggaaga 

tcatgtgaaa 

tggcaagggt 

tgctgaagag 

taggagacat 

aattaaacag 



ggcacaaaat 
cccctcatca 
ttcatcaagt 
attggtgtaa 
gatgccaatg 
aacaaaccat 
agagacaaga 
gcctggaaag 
ccatg 



gaatcccgca 
aggtgaacga 
ttgacactgg 
tcaccaacag 
gcaacagctt 
ggatctctct 
ggcttgcggc 
ttgttttgta 



cctggtgacc 
caccattcag 
gaacctgtgt: 
agagagacat 
tgccactcgg 
tcccagagga 
caaacagagc 
caacctttcc 



catgatgctc 
attgatttgg 
atggtgactg 
cccggctctt 
ctgtccaaca 
aaaggaatcc 
agtgggttga 
taggcaacat 



gtactattcg 60 
agacaggcaa 120 
gaggtgctaa 180 
ttgatgtggt 240 
tttttgttat 300 
gcctcaccat 360 
aatggtctcc 420 
acattgctag 480 
495 



<210> 71 
<211> 136 
<212> DNA 
<213> murine 

<400> 71 

cgatcgagag ggcaaaccac ggaaggtggt tggttgcagt tgcgtagtgg ttaaggacta 60 

tggcaaagaa tctcaggcca aggatgtcat cgaggaaata cttcaagtgc aagaaataaa 120 
taaattttgg ctgatt 136 

<210> 72 
<211> 140 
<212> DNA 
<213> murine 

<400> 72 

attccagatg aggaccacaa gcgactcatt gatttacata gtccttctga gattgttaag 60 

cagattactt ccatcagtat tgagccggga gttgaggttg aagtcaccat tgcagatgcc 120 

taagacaact gaataaatcg 14 0 

<210> 73 
<211> 216 
<212> DNA 
<213> murine 

<400> 73 

gatctataca gtcgggaaac gcttcaagga agcaaataac ttcctgtggc ccttcaagtt 60 

atcttcccca cgaggtggga tgaagaaaaa gacaactcac tttgtagaag gtggagatgc 120 

tggcaacagg gaagaccaga taaacaggct tattagacgg atgaactaag gtgtcaccca 180 

ttgtattttt gtaatctggt cagttaataa acagtc 216 

<210> 74 
<211> 151 
<212> DNA 
<213> murine 

<400> 74 

cgatgtggcc aaagtcaata ccctgataag gcccgacgga gagaagaagg cgtatgttcg 60 

cttggctcct gattatgatg ccctagatgt tgccaacaag attgggatca tctaaactga 120 

gtccagatgg ctaattctaa atatatactt t 151 



<210> 75 



SUBSTITUTE SHEET (RULE 26) 

BNSDOCID: <WO 991053SA1_IA> 



wo 99/10535 



19 



PCT/US98/17283 



<211> 90 
<212> DNA 
<213> murine 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 75 

gatctggaac catagatgcg agcatcagca acagaataca agaaatggaa gngngaatct 60 
caggtgcaga agnttccata gagaacatcg 90 

<210> 76 
<211> 257 
<212> DNA 
<213> murine 

<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 76 

gcgatgcaaa atccttaata naattcttgc taaccgaatc caagaacaca ttaaagcaat 60 

catccatcct gaccaagtag gttttattcc agggatgcng ngatggttta atatatgaaa 120* 

atccatcaat gtaatccatt ntataaacaa nctcaangac anaaaccaca tgatcatctc 180 

gttagntgca gaaaaagcat ttgacaagat ccaacacaca ttcgtgataa nagttttggn 240 

aagatcagga attcaag 257 

<210> 77 
<211> 200 
<212> DNA 
<213> murine 



<220> 

<221> variation 
<222> (various) 

<223> bases designated as "n" at various positions 
throughout the sequence may be A, T, C or G 

<400> 77 

cgatnnaccc gctctacctc accatctctt gctaattcag cctatatacc gccatcttca 60 

gcaaacccta aatnaggtat taaagtaagc atcnagaatc anccatactc aacgtnacgt 120 

caaggtgtac ccaatgnaat gggaagaaat gggctacatt ttcttatana agaacattnc 180 

tatacccttt ntgaaactaa 200 

<210> 78 
<211> 56 

<212> DNA : . 

<213> oligo used in gene expression 

<400> 78 

acgtaatacg actcactata gggcgaattg ggtcgacttt tttttttttt tttttv 56 

<210> 79 
<211> 21 
<212> DNA 

<213> oligo used in gene expression 



BNSDOCID: <WO S910535A1_IA: 



SUBSTITUTE SHEET (RULE 26) 



wo 99/10535 



20 



PCT/US98/17283 



<400> 79 

cttacagcgg ccgcttggac g 21 

<210> 80 
<211> 15 
<212> DNA 

<213> oligo used in gene expression 
<400> 80 

agcggccgct gtaag ^5 

<210> 81 
<211> 30 
<212> DNA 

<213> oligo used in gene expression 
<400> 81 

gcggaattcc gtccaagcgg ccgctgtaag 30 

(. 

<210> 82 
<211> 21 
<212> DNA 

<213> adapter oligo 
<400> 82 

cttacagcgg ccgcttggac g 21 . 

<210> 83 
<211> 15 
<212> DNA 

<213> adapter oligo 
<400> 83 

gaatgtcgcc ggcga 15 

<210> 84 
<211> 25 
<212> DNA 

<213> adapter oligo 
<400> 84 

tagcgtccgg cgcagcgacg gccag 25 

<210> 85 
<211> 29 ' 
<212> DNA 

<213> adapter oligo 
<400> 85 

gatcctggcc gtcggctgtc tgtcggcgc 

<210> 86 
<211> 30 
<212> DNA 
<213> primer 

. <400> 86 

gcggaattcc gtccaagcgg ccgctgtaag . 

<210> 87 



SUBSTrrUTE SHEET (RULE 26) 

BNSDOCID: <WO 9910535A1JA> 



wo 99/10535 



PCT/US98/17283 



21 



<211> 40 
<212> DNA 
<213> primer 



<400> 87 

ctctcaagga tcttaccgct tttttttttt ttttttttat 



40 



<210> 88 
<211> 40 
<212> DNA 
<213> primer 

<400> 88 

taataccgcg ccacatagca tttttttttt ttttttttcg 40 

<210> 89 
<211> 40 
<212> DNA 
<213> primer 



<210> 90 
<211> 19 
<212> DNA 
<213> primer 

<400> 90 

tagcgtccgg cgcagcgac 19 

<210> 91 
<211> 19 
<212> DNA 
<213> primer 



<210> 92 
<211> 20 
<212> DNA 
<213> primer 

<400> 92 

cagggtagac gacgctacgc 20 

<210> 93 
<211> 20 
<212> DNA 
<213> primer 



<400> 89 

cagggtagac gacgctacgc tttttttttt ttttttttga 



40 



<400> 91 

ctctcaagga tctaccgct 



19 



<400> 93 

taataccgcg ccacatagca. 



20 



SUBSTITUTE SHEET (RULE 26) 



BNSOOCID: <:WO. 



.991053 5A1_IA> 



INTERNATIONAL SEARCH REPORT 



Inteinational application No. 
PCT/US98/17283 



I A. CLASSIFICATION OF SUBJECT MATTER 

IPC(6) :C12Q 1/68; C12N 15/12 
I A^il rfL to tatetateonal Patent Classificatioo (IPC) or to both na tional classification and IPC 

p. FIELDS SEARCHED 

i Minimum docnmentatioo searched (classification system followed by classification symbols) 

U.S. : 435/6, 536/23.5 



rBocumenUttion .~.chcd other than minimum documentation to the extent ti.a. such documents arc included in the fields searched 

[Electwnic data base consulted during the international search (name of date base and. where practicable, search tenns used) 

APS, Medline. WPIDS . . . 

Msareh tenns: hematopoietic stem ceH. differential display 



DOCUMENTS CONSIDERED TO BE RELEVANT 



Category* 



CiUtion of document, with indication, where appropriate, of the relevant passages 

TAGOH et al. Molecular Cloning and Characterization of a Novel 
Stromal Cell-Derived cDNA Encoding a Protein That Facilitates 
Gene Activation of Recombination Activating Gene (RAG)-l in 
Human Lymphoid Progenitors. Biochem. Biophys Res. Commun. 
1996. Vol. 221, pages 744-749, especially page 744. 

MORES et al. Human Al, a Bcl-2-related gene, is induced in 
leukemic cells by cytokines as well as differentiating factors. 
Leukemia. July 1997, Vol. 11, Number 7, pages 998-1004, 
especially page 998. 



Relevant to claim No. 

1.2 



1,2 



□ Further document, are lirtcd in the continuation of Box C. Q See patent family annex 



• Specwt oatagoai«s of oitad documMSs: ' 

•A* document a«riiims tbo Rmwtml ■t«U» of th« «rt which u ixit eoniidewd 

to be of p«rbculsr nl«v«fice 
•B- •mrVm docum«ol p»ibU.h«l oo or after tb« int«n»tkm«l fiHng aal« 

document which mmy throw doubts oo priority claim<t) or which is 

cilMi to ottabbih the publication date of another citaUon or other 

•pMial reason (as specified) 
•O- document refemni to an of»l disclosure, use, exhibition or other 

.p. doctnneol published prior to iho intwnational Wing date but Uter than 
the priority date claimod , — 

I Date of the actual complcticm of the intemattonal search 
30 NOVEMBER 1998 



Ister document published after 4he international filing date or pnonty 
date and not in conflict with the application but cited to understand 
the principle or theory underlying the inventioo 

document of particular relevance; the claimed invention cannot be 
considered novel or carmot be considered to invoWe en mventnre step 
when the document is taken alone 

document of particular relevance; the claimed invention cannot bo 
considered to involve an inventive step when Oic document u 
combined with one or more other such doctmientt. such corobmsuon 
being envious u> a person skilled in the art 



*&* document member of the same patent family 



I Name and mailiag aiidress of the ISAAJS 
Commusioocr of Patents and Trtdcmaito 
Box PCX 

Wathingtofu D.C 30231 
I Facsioiile No. (703) 305-3230 



Date of mailing of the international search report 

24DECJ998 



r 



Authorized officer 

JOHN S, BRUSCA 
Telephone No. (703) 308-0196 




Form PCT/ISA/210 (second shectXJuly 1992)* 



: cWO ©910535A1 IA> 



INTERNATIONAL SEARCH REPORT 



Intcniational application No. 
PCT/US98/17283 



Box I Observmtiona where certain claims were found unsearchable (Continuation of item 1 of Tirst sheet) 



This intcroaliooal report has not been established in respect of certain claims under Article 17(2Xa) for the following reasons: 



□ 



Claims Nos.: 

because they relate to subject matter riot required to be searched by this Authority, namely: 



S Claims Nos.: 3 
because they relate to parts of tfie international application that do not comply with the prescnbed requirements to such 
an extent that no meaningful international search can be carried out, specifically: 

No sequence listing or computer readable form of sequence listing has been supplied, and claim 3 is drawn to specific 
sequences that therefore cannot be searched. 

I I Claims Nos.: 

because th^ are dependent claims and arc not drafted in accordance with the second and third sentences of Rule 6.4(a). 



Box II Obaervatlona where unity of Invention Is lacking (Continuation of Item 2 of first sheet) 



This International Searching Authority found multiple inventions in this international application, as follows: 



1. j 1 Aa all required additional search fees were timely paid by the applicant, this international search report covers alt searchable 

claims. 



2. Aa all searchable claims could be searched without effort justifying an additional fee. this Authority did not invite payment 
of any additional fee. 

3. rn As only some of the required additional search fees were timely paid by the applicant, this international search report covers 
cmly those claims for which fees were paid, specifically claims Nos.: 



4. I I No required additional search fees were timely paid by the applicant Consequently, this international search report is 
restricted to the invention first mentioned in the claims; it is covered by claims Nos.: 



Remark on Protest \ \ The additional search fees were accompanied by the applicant's protest 

I I No protest accompanied the payment of additional search fees. 



Form PCT/ISA/210 (continuation of first sheet<I)XJuly 1992)*